EMAIL THIS PAGE TO A FRIEND

SH3GL1

SH3-domain GRB2-like 1

51 Gene Product Result for
Synonyms: CNSA1 EEN SH3D2B SH3P8
UniProtKB ID: Q99961, B4DRA1, E7EVZ4, M0QZV5, Q99668
Gene ID:
Human(6455) Summary: This gene encodes a member of the endophilin family of Src homology 3 domain-containing proteins. The encoded protein is involved in endocytosis and may also play a role in the cell cycle. Overexpression of this gene may play a role in leukemogenesis, and the encoded protein has been implicated in acute myeloid leukemia as a fusion partner of the myeloid-lymphoid leukemia protein. Pseudogenes of this gene are located on the long arm of chromosomes 11 and 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(20405) SH3-domain GRB2-like 1
Rat(81922) SH3-domain GRB2-like 1
cow(512719) SH3-domain GRB2-like 1
sheep(101114868) SH3-domain GRB2-like 1
naked mole-rat(101700266) SH3-domain GRB2-like 1
domestic guinea pig(100735863) SH3-domain GRB2-like 1
chicken(395202) SH3-domain GRB2-like 1
domestic cat(101080869) SH3-domain GRB2-like 1
dog(485039) SH3-domain GRB2-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100596 Anti-SH3GL1 (256-270) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1100597 Anti-SH3GL1 (291-305) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
GW22560F Anti-SH3GL1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
SAB2501683 Anti-SH3GL1 antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, human, canine
ELISA, immunohistochemistry, western blot pricing
HPA021485 Anti-SH3GL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200650 Monoclonal Anti-SH3GL1 (C-terminal) antibody produced in mouse clone Ep2.17, purified from hybridoma cell culture human
flow cytometry, western blot pricing
WH0006455M1 Monoclonal Anti-SH3GL1 antibody produced in mouse clone 2E8-H5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404368 Monoclonal Anti-SH3GL1 antibody produced in mouse clone 2B5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100236 Monoclonal Anti-SH3GL1 antibody produced in mouse clone SH3GL1-A201, culture supernatant human
western blot pricing
SAB4100237 Monoclonal Anti-SH3GL1 antibody produced in mouse clone SH3GL1-B201, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003025 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003025 Rosetta Predictions human pricing
NM_031239 Rosetta Predictions rat pricing
NM_013664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082828 predicted 232
2 SASI_Hs01_00082829 predicted 1105
3 SASI_Hs01_00082830 predicted 1031
4 SASI_Hs01_00082831 predicted 419
5 SASI_Hs01_00082837 predicted 1601
6 SASI_Hs02_00334922 predicted 425
7 SASI_Hs02_00334923 predicted 946
8 SASI_Hs02_00334924 predicted 399
9 SASI_Hs02_00334925 predicted 1156
10 SASI_Hs01_00082834 predicted 1159
11 SASI_Hs01_00082832 predicted 604
12 SASI_Hs01_00082833 predicted 1408
13 SASI_Hs01_00082835 predicted 1525
14 SASI_Hs01_00082836 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068177 predicted 290
2 SASI_Rn01_00068178 predicted 1413
3 SASI_Rn02_00264517 predicted 489
4 SASI_Rn01_00068179 predicted 437
5 SASI_Rn01_00068180 predicted 1580
6 SASI_Rn01_00068181 predicted 474
7 SASI_Rn01_00068182 predicted 1612
8 SASI_Rn02_00264518 predicted 477
9 SASI_Rn01_00068185 predicted 303
10 SASI_Rn01_00068186 predicted 666
11 SASI_Rn01_00068183 predicted 924
12 SASI_Rn01_00068184 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105031 predicted 273
2 SASI_Mm01_00105033 predicted 1696
3 SASI_Mm01_00105034 predicted 1701
4 SASI_Mm01_00105035 predicted 970
5 SASI_Mm01_00105036 predicted 523
6 SASI_Mm01_00105037 predicted 989
7 SASI_Mm01_00105038 predicted 1224
8 SASI_Mm01_00105039 predicted 210
9 SASI_Mm02_00322500 predicted 898
10 SASI_Mm01_00105040 predicted 1618
11 SASI_Mm01_00105032 predicted 1377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013664
SH3GL1 MISSION shRNA Bacterial Glycerol Stock
SH3-domain GRB2-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013664.2-321s21c1
Sequence:GTACCGGGACTATGCTGAACACCGTATCCTCGAGGATACGGTGTTCAGCATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013664.2-518s21c1
Sequence:CCGGAGGTCAAGCAGAACTTCATTGCTCGAGCAATGAAGTTCTGCTTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013664.2-1342s21c1
Sequence:CCGGCCCTATCCTAAGACTCGGAAACTCGAGTTTCCGAGTCTTAGGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013664.2-971s21c1
Sequence:CCGGCCTCCTCATCATTTAGATCGTCTCGAGACGATCTAAATGATGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013664.1-971s1c1
Sequence:CCGGCCTCCTCATCATTTAGATCGTCTCGAGACGATCTAAATGATGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013664.2-609s21c1
Sequence:CCGGCCGCCTTGACTTTGACTACAACTCGAGTTGTAGTCAAAGTCAAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013664.1-278s1c1
Sequence:CCGGCCATAGAATATCTGCAGCCTACTCGAGTAGGCTGCAGATATTCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013664.1-1342s1c1
Sequence:CCGGCCCTATCCTAAGACTCGGAAACTCGAGTTTCCGAGTCTTAGGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013664.1-197s1c1
Sequence:CCGGCCAAACTGGATGATGACTTTACTCGAGTAAAGTCATCATCCAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013664.1-609s1c1
Sequence:CCGGCCGCCTTGACTTTGACTACAACTCGAGTTGTAGTCAAAGTCAAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013664
SH3GL1 MISSION shRNA shRNA Plasmid DNA
SH3-domain GRB2-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013664.2-321s21c1
Sequence:GTACCGGGACTATGCTGAACACCGTATCCTCGAGGATACGGTGTTCAGCATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013664.2-518s21c1
Sequence:CCGGAGGTCAAGCAGAACTTCATTGCTCGAGCAATGAAGTTCTGCTTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013664.2-1342s21c1
Sequence:CCGGCCCTATCCTAAGACTCGGAAACTCGAGTTTCCGAGTCTTAGGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013664.2-971s21c1
Sequence:CCGGCCTCCTCATCATTTAGATCGTCTCGAGACGATCTAAATGATGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013664.1-971s1c1
Sequence:CCGGCCTCCTCATCATTTAGATCGTCTCGAGACGATCTAAATGATGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013664.2-609s21c1
Sequence:CCGGCCGCCTTGACTTTGACTACAACTCGAGTTGTAGTCAAAGTCAAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013664.1-278s1c1
Sequence:CCGGCCATAGAATATCTGCAGCCTACTCGAGTAGGCTGCAGATATTCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013664.1-1342s1c1
Sequence:CCGGCCCTATCCTAAGACTCGGAAACTCGAGTTTCCGAGTCTTAGGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013664.1-197s1c1
Sequence:CCGGCCAAACTGGATGATGACTTTACTCGAGTAAAGTCATCATCCAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013664.1-609s1c1
Sequence:CCGGCCGCCTTGACTTTGACTACAACTCGAGTTGTAGTCAAAGTCAAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013664
SH3GL1 MISSION shRNA Lentiviral Transduction Particles
SH3-domain GRB2-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013664.2-321s21c1
Sequence:GTACCGGGACTATGCTGAACACCGTATCCTCGAGGATACGGTGTTCAGCATAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013664.2-518s21c1
Sequence:CCGGAGGTCAAGCAGAACTTCATTGCTCGAGCAATGAAGTTCTGCTTGACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013664.2-1342s21c1
Sequence:CCGGCCCTATCCTAAGACTCGGAAACTCGAGTTTCCGAGTCTTAGGATAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013664.2-971s21c1
Sequence:CCGGCCTCCTCATCATTTAGATCGTCTCGAGACGATCTAAATGATGAGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013664.1-971s1c1
Sequence:CCGGCCTCCTCATCATTTAGATCGTCTCGAGACGATCTAAATGATGAGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013664.2-609s21c1
Sequence:CCGGCCGCCTTGACTTTGACTACAACTCGAGTTGTAGTCAAAGTCAAGGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013664.1-278s1c1
Sequence:CCGGCCATAGAATATCTGCAGCCTACTCGAGTAGGCTGCAGATATTCTATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013664.1-1342s1c1
Sequence:CCGGCCCTATCCTAAGACTCGGAAACTCGAGTTTCCGAGTCTTAGGATAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013664.1-197s1c1
Sequence:CCGGCCAAACTGGATGATGACTTTACTCGAGTAAAGTCATCATCCAGTTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013664.1-609s1c1
Sequence:CCGGCCGCCTTGACTTTGACTACAACTCGAGTTGTAGTCAAAGTCAAGGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003025
VALIDATED
SH3GL1 MISSION shRNA Bacterial Glycerol Stock
SH3-domain GRB2-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003025.2-853s21c1
Sequence:CCGGACGCCCTAAGCGGGAGTATAACTCGAGTTATACTCCCGCTTAGGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003025.2-1111s21c1
Sequence:CCGGGACCAACCAGATCGATGAGAACTCGAGTTCTCATCGATCTGGTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003025.2-2190s21c1
Sequence:CCGGTGCTTCCTCTATCGCCCAATGCTCGAGCATTGGGCGATAGAGGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003025.2-953s21c1
Sequence:CCGGATCGCAGCTTCATCGTCTTTCCTCGAGGAAAGACGATGAAGCTGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003025.2-428s21c1
Sequence:CCGGTCCAACTTTGGTGACGCATTGCTCGAGCAATGCGTCACCAAAGTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_003025.2-1102s1c1
Sequence:CCGGCATCACGCTGACCAACCAGATCTCGAGATCTGGTTGGTCAGCGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_003025.2-1530s1c1
Sequence:CCGGGCTCTTAGAAACACTAATGTTCTCGAGAACATTAGTGTTTCTAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003025.2-427s1c1
Sequence:CCGGGTCCAACTTTGGTGACGCATTCTCGAGAATGCGTCACCAAAGTTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003025.2-506s1c1
Sequence:CCGGGAGGTCAAGCAGAACTTCATTCTCGAGAATGAAGTTCTGCTTGACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003025.2-852s1c1
Sequence:CCGGCACGCCCTAAGCGGGAGTATACTCGAGTATACTCCCGCTTAGGGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003025
VALIDATED
SH3GL1 MISSION shRNA shRNA Plasmid DNA
SH3-domain GRB2-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003025.2-853s21c1
Sequence:CCGGACGCCCTAAGCGGGAGTATAACTCGAGTTATACTCCCGCTTAGGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003025.2-1111s21c1
Sequence:CCGGGACCAACCAGATCGATGAGAACTCGAGTTCTCATCGATCTGGTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003025.2-2190s21c1
Sequence:CCGGTGCTTCCTCTATCGCCCAATGCTCGAGCATTGGGCGATAGAGGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003025.2-953s21c1
Sequence:CCGGATCGCAGCTTCATCGTCTTTCCTCGAGGAAAGACGATGAAGCTGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003025.2-428s21c1
Sequence:CCGGTCCAACTTTGGTGACGCATTGCTCGAGCAATGCGTCACCAAAGTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_003025.2-1102s1c1
Sequence:CCGGCATCACGCTGACCAACCAGATCTCGAGATCTGGTTGGTCAGCGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_003025.2-1530s1c1
Sequence:CCGGGCTCTTAGAAACACTAATGTTCTCGAGAACATTAGTGTTTCTAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003025.2-427s1c1
Sequence:CCGGGTCCAACTTTGGTGACGCATTCTCGAGAATGCGTCACCAAAGTTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003025.2-506s1c1
Sequence:CCGGGAGGTCAAGCAGAACTTCATTCTCGAGAATGAAGTTCTGCTTGACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003025.2-852s1c1
Sequence:CCGGCACGCCCTAAGCGGGAGTATACTCGAGTATACTCCCGCTTAGGGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003025
VALIDATED
SH3GL1 MISSION shRNA Lentiviral Transduction Particles
SH3-domain GRB2-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003025.2-853s21c1
Sequence:CCGGACGCCCTAAGCGGGAGTATAACTCGAGTTATACTCCCGCTTAGGGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003025.2-1111s21c1
Sequence:CCGGGACCAACCAGATCGATGAGAACTCGAGTTCTCATCGATCTGGTTGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003025.2-2190s21c1
Sequence:CCGGTGCTTCCTCTATCGCCCAATGCTCGAGCATTGGGCGATAGAGGAAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003025.2-953s21c1
Sequence:CCGGATCGCAGCTTCATCGTCTTTCCTCGAGGAAAGACGATGAAGCTGCGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003025.2-428s21c1
Sequence:CCGGTCCAACTTTGGTGACGCATTGCTCGAGCAATGCGTCACCAAAGTTGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_003025.2-1102s1c1
Sequence:CCGGCATCACGCTGACCAACCAGATCTCGAGATCTGGTTGGTCAGCGTGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_003025.2-1530s1c1
Sequence:CCGGGCTCTTAGAAACACTAATGTTCTCGAGAACATTAGTGTTTCTAAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003025.2-427s1c1
Sequence:CCGGGTCCAACTTTGGTGACGCATTCTCGAGAATGCGTCACCAAAGTTGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003025.2-506s1c1
Sequence:CCGGGAGGTCAAGCAGAACTTCATTCTCGAGAATGAAGTTCTGCTTGACCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003025.2-852s1c1
Sequence:CCGGCACGCCCTAAGCGGGAGTATACTCGAGTATACTCCCGCTTAGGGCGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)