EMAIL THIS PAGE TO A FRIEND

SH3GL3

SH3-domain GRB2-like 3

56 Gene Product Result for
Synonyms: CNSA3 EEN-2B-L3 EEN-B2 HsT19371 SH3D2C SH3P13
UniProtKB ID: Q99963, O43553, O43554
Gene ID:
Mouse(20408) SH3-domain GRB2-like 3
Rat(81921) SH3-domain GRB2-like 3
cow(520311) SH3-domain GRB2-like 3
sheep(101111833) SH3-domain GRB2-like 3
naked mole-rat(101708553) SH3-domain GRB2-like 3
domestic guinea pig(100723391) SH3-domain GRB2-like 3
chicken(395201) SH3-domain GRB2-like 3
domestic cat(101088933) SH3-domain GRB2-like 3
dog(609858) SH3-domain GRB2-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003027 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003027 Rosetta Predictions human pricing
NM_031238 Rosetta Predictions rat pricing
NM_017400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216244 predicted 702
2 SASI_Hs01_00216245 predicted 1549
3 SASI_Hs01_00216246 predicted 583
4 SASI_Hs01_00216247 predicted 1386
5 SASI_Hs01_00216248 predicted 878
6 SASI_Hs01_00216249 predicted 1306
7 SASI_Hs01_00216250 predicted 1297
8 SASI_Hs01_00216251 predicted 498
9 SASI_Hs02_00334927 predicted 496
10 SASI_Hs01_00216253 predicted 861
11 SASI_Hs01_00216252 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032852 predicted 772
2 SASI_Rn01_00032853 predicted 475
3 SASI_Rn01_00032854 predicted 725
4 SASI_Rn01_00032855 predicted 1095
5 SASI_Rn02_00264515 predicted 1127
6 SASI_Rn01_00032857 predicted 985
7 SASI_Rn02_00264516 predicted 984
8 SASI_Rn01_00032858 predicted 1072
9 SASI_Rn01_00032859 predicted 1069
10 SASI_Rn01_00032860 predicted 780
11 SASI_Rn01_00032851 predicted 728
12 SASI_Rn01_00032856 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162013 predicted 302
2 SASI_Mm01_00162014 predicted 985
3 SASI_Mm01_00162015 predicted 703
4 SASI_Mm02_00323903 predicted 235
5 SASI_Mm02_00323904 predicted 491
6 SASI_Mm02_00323905 predicted 837
7 SASI_Mm01_00162006 predicted 1164
8 SASI_Mm01_00162007 predicted 1141
9 SASI_Mm02_00323906 predicted 241
10 SASI_Mm01_00162010 predicted 1041
11 SASI_Mm01_00162008 predicted 1065
12 SASI_Mm01_00162009 predicted 252
13 SASI_Mm01_00162011 predicted 1227
14 SASI_Mm01_00162012 predicted 722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003027
SH3GL3 MISSION shRNA Bacterial Glycerol Stock
SH3-domain GRB2-like 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003027.3-573s21c1
Sequence:CCGGGGTGAAAGACTCTCTTGATATCTCGAGATATCAAGAGAGTCTTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-940s1c1
Sequence:CCGGCCACTTCAGTTACTACAAGATCTCGAGATCTTGTAGTAACTGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-1229s1c1
Sequence:CCGGGCAAGCTACAGATGCGAATATCTCGAGATATTCGCATCTGTAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-1486s1c1
Sequence:CCGGGAAGGAATGATACACGGAGAACTCGAGTTCTCCGTGTATCATTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-704s1c1
Sequence:CCGGCATACAGAGCTAAGCTAGGAACTCGAGTTCCTAGCTTAGCTCTGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003027.2-1628s1c1
Sequence:CCGGCGGTGTTCTGTGACATCCTTTCTCGAGAAAGGATGTCACAGAACACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003027.3-1249s21c1
Sequence:CCGGACAAACTCTGGACATACTTTCCTCGAGGAAAGTATGTCCAGAGTTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003027.3-274s21c1
Sequence:CCGGACTAAACTAGACGATGAATTTCTCGAGAAATTCATCGTCTAGTTTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003027.2-1859s1c1
Sequence:CCGGCCTATATTCCTCAGCTGCAATCTCGAGATTGCAGCTGAGGAATATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-677s1c1
Sequence:CCGGCCACTGAATATCTTCAGCCAACTCGAGTTGGCTGAAGATATTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003027
SH3GL3 MISSION shRNA shRNA Plasmid DNA
SH3-domain GRB2-like 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003027.3-573s21c1
Sequence:CCGGGGTGAAAGACTCTCTTGATATCTCGAGATATCAAGAGAGTCTTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-940s1c1
Sequence:CCGGCCACTTCAGTTACTACAAGATCTCGAGATCTTGTAGTAACTGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-1229s1c1
Sequence:CCGGGCAAGCTACAGATGCGAATATCTCGAGATATTCGCATCTGTAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-1486s1c1
Sequence:CCGGGAAGGAATGATACACGGAGAACTCGAGTTCTCCGTGTATCATTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-704s1c1
Sequence:CCGGCATACAGAGCTAAGCTAGGAACTCGAGTTCCTAGCTTAGCTCTGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003027.2-1628s1c1
Sequence:CCGGCGGTGTTCTGTGACATCCTTTCTCGAGAAAGGATGTCACAGAACACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003027.3-1249s21c1
Sequence:CCGGACAAACTCTGGACATACTTTCCTCGAGGAAAGTATGTCCAGAGTTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003027.3-274s21c1
Sequence:CCGGACTAAACTAGACGATGAATTTCTCGAGAAATTCATCGTCTAGTTTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003027.2-1859s1c1
Sequence:CCGGCCTATATTCCTCAGCTGCAATCTCGAGATTGCAGCTGAGGAATATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-677s1c1
Sequence:CCGGCCACTGAATATCTTCAGCCAACTCGAGTTGGCTGAAGATATTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003027
SH3GL3 MISSION shRNA Lentiviral Transduction Particles
SH3-domain GRB2-like 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003027.3-573s21c1
Sequence:CCGGGGTGAAAGACTCTCTTGATATCTCGAGATATCAAGAGAGTCTTTCACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-940s1c1
Sequence:CCGGCCACTTCAGTTACTACAAGATCTCGAGATCTTGTAGTAACTGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-1229s1c1
Sequence:CCGGGCAAGCTACAGATGCGAATATCTCGAGATATTCGCATCTGTAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-1486s1c1
Sequence:CCGGGAAGGAATGATACACGGAGAACTCGAGTTCTCCGTGTATCATTCCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-704s1c1
Sequence:CCGGCATACAGAGCTAAGCTAGGAACTCGAGTTCCTAGCTTAGCTCTGTATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003027.2-1628s1c1
Sequence:CCGGCGGTGTTCTGTGACATCCTTTCTCGAGAAAGGATGTCACAGAACACCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003027.3-1249s21c1
Sequence:CCGGACAAACTCTGGACATACTTTCCTCGAGGAAAGTATGTCCAGAGTTTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003027.3-274s21c1
Sequence:CCGGACTAAACTAGACGATGAATTTCTCGAGAAATTCATCGTCTAGTTTAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003027.2-1859s1c1
Sequence:CCGGCCTATATTCCTCAGCTGCAATCTCGAGATTGCAGCTGAGGAATATAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003027.2-677s1c1
Sequence:CCGGCCACTGAATATCTTCAGCCAACTCGAGTTGGCTGAAGATATTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017400
VALIDATED
SH3GL3 MISSION shRNA Bacterial Glycerol Stock
SH3-domain GRB2-like 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017400.4-261s21c1
Sequence:CCGGCCAGTAAAGCTGTTGCAGAAACTCGAGTTTCTGCAACAGCTTTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017400.4-1336s21c1
Sequence:CCGGGATTTCTTTGTCCTAACTCATCTCGAGATGAGTTAGGACAAAGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-1362s1c1
Sequence:CCGGGATTTCTTTGTCCTAACTCATCTCGAGATGAGTTAGGACAAAGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-296s1c1
Sequence:CCGGCTGTTGCAGAAATCCTTTCAACTCGAGTTGAAAGGATTTCTGCAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-287s1c1
Sequence:CCGGCCAGTAAAGCTGTTGCAGAAACTCGAGTTTCTGCAACAGCTTTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-694s1c1
Sequence:CCGGCCCGAGGAAGAAATCAGACAACTCGAGTTGTCTGATTTCTTCCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-885s1c1
Sequence:CCGGGCGAATATCTCTTGCATCCAACTCGAGTTGGATGCAAGAGATATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017400.4-270s21c1
Sequence:CCGGCTGTTGCAGAAATCCTTTCAACTCGAGTTGAAAGGATTTCTGCAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017400.4-859s21c1
Sequence:CCGGGCGAATATCTCTTGCATCCAACTCGAGTTGGATGCAAGAGATATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017400
VALIDATED
SH3GL3 MISSION shRNA shRNA Plasmid DNA
SH3-domain GRB2-like 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017400.4-261s21c1
Sequence:CCGGCCAGTAAAGCTGTTGCAGAAACTCGAGTTTCTGCAACAGCTTTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017400.4-1336s21c1
Sequence:CCGGGATTTCTTTGTCCTAACTCATCTCGAGATGAGTTAGGACAAAGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-1362s1c1
Sequence:CCGGGATTTCTTTGTCCTAACTCATCTCGAGATGAGTTAGGACAAAGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-296s1c1
Sequence:CCGGCTGTTGCAGAAATCCTTTCAACTCGAGTTGAAAGGATTTCTGCAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-287s1c1
Sequence:CCGGCCAGTAAAGCTGTTGCAGAAACTCGAGTTTCTGCAACAGCTTTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-694s1c1
Sequence:CCGGCCCGAGGAAGAAATCAGACAACTCGAGTTGTCTGATTTCTTCCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-885s1c1
Sequence:CCGGGCGAATATCTCTTGCATCCAACTCGAGTTGGATGCAAGAGATATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017400.4-270s21c1
Sequence:CCGGCTGTTGCAGAAATCCTTTCAACTCGAGTTGAAAGGATTTCTGCAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017400.4-859s21c1
Sequence:CCGGGCGAATATCTCTTGCATCCAACTCGAGTTGGATGCAAGAGATATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017400
VALIDATED
SH3GL3 MISSION shRNA Lentiviral Transduction Particles
SH3-domain GRB2-like 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017400.4-261s21c1
Sequence:CCGGCCAGTAAAGCTGTTGCAGAAACTCGAGTTTCTGCAACAGCTTTACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017400.4-1336s21c1
Sequence:CCGGGATTTCTTTGTCCTAACTCATCTCGAGATGAGTTAGGACAAAGAAATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-1362s1c1
Sequence:CCGGGATTTCTTTGTCCTAACTCATCTCGAGATGAGTTAGGACAAAGAAATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-296s1c1
Sequence:CCGGCTGTTGCAGAAATCCTTTCAACTCGAGTTGAAAGGATTTCTGCAACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-287s1c1
Sequence:CCGGCCAGTAAAGCTGTTGCAGAAACTCGAGTTTCTGCAACAGCTTTACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-694s1c1
Sequence:CCGGCCCGAGGAAGAAATCAGACAACTCGAGTTGTCTGATTTCTTCCTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017400.1-885s1c1
Sequence:CCGGGCGAATATCTCTTGCATCCAACTCGAGTTGGATGCAAGAGATATTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017400.4-270s21c1
Sequence:CCGGCTGTTGCAGAAATCCTTTCAACTCGAGTTGAAAGGATTTCTGCAACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017400.4-859s21c1
Sequence:CCGGGCGAATATCTCTTGCATCCAACTCGAGTTGGATGCAAGAGATATTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)