EMAIL THIS PAGE TO A FRIEND

SH3GLB2

SH3-domain GRB2-like endophilin B2

49 Gene Product Result for
Synonyms: PP6569 PP9455 RRIG1
UniProtKB ID: Q9NR46, A6NC47, A8MPS4, Q8WY61, Q96JH9
Gene ID:
Mouse(227700) SH3-domain GRB2-like endophilin B2
Rat(311848) SH3-domain GRB2-like endophilin B2
cow(504750) SH3-domain GRB2-like endophilin B2
sheep(101106157) SH3-domain GRB2-like endophilin B2
naked mole-rat(101710203) SH3-domain GRB2-like endophilin B2
domestic guinea pig(100712649) SH3-domain GRB2-like endophilin B2
chicken(417197) SH3-domain GRB2-like endophilin B2
Horse(100070104) SH3-domain GRB2-like endophilin B2
domestic cat(101094549) SH3-domain GRB2-like endophilin B2
dog(491306) SH3-domain GRB2-like endophilin B2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020145 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020145 Rosetta Predictions human pricing
NM_001009692 Rosetta Predictions rat pricing
NM_139302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184203 predicted 949
2 SASI_Hs01_00184204 predicted 719
3 SASI_Hs02_00353037 predicted 842
4 SASI_Hs01_00184205 predicted 651
5 SASI_Hs01_00184206 predicted 849
6 SASI_Hs01_00184207 predicted 734
7 SASI_Hs01_00184208 predicted 818
8 SASI_Hs01_00184209 predicted 902
9 SASI_Hs01_00184211 predicted 723
10 SASI_Hs01_00184212 predicted 486
11 SASI_Hs01_00184210 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097867 predicted 402
2 SASI_Rn01_00097868 predicted 728
3 SASI_Rn01_00097869 predicted 1294
4 SASI_Rn01_00097870 predicted 917
5 SASI_Rn01_00097871 predicted 1587
6 SASI_Rn01_00097872 predicted 1268
7 SASI_Rn01_00097873 predicted 608
8 SASI_Rn01_00097875 predicted 862
9 SASI_Rn02_00199752 predicted 726
10 SASI_Rn01_00097876 predicted 1350
11 SASI_Rn01_00097874 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069962 predicted 825
2 SASI_Mm01_00069963 predicted 614
3 SASI_Mm01_00069964 predicted 1438
4 SASI_Mm01_00069965 predicted 537
5 SASI_Mm01_00069966 predicted 1167
6 SASI_Mm01_00069968 predicted 1408
7 SASI_Mm02_00339992 predicted 781
8 SASI_Mm01_00069969 predicted 1087
9 SASI_Mm01_00069970 predicted 1239
10 SASI_Mm02_00339993 predicted 640
11 SASI_Mm01_00069967 predicted 233
12 SASI_Mm01_00069971 predicted 878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139302
VALIDATED
SH3GLB2 MISSION shRNA Bacterial Glycerol Stock
SH3-domain GRB2-like endophilin B2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-799s21c1
Sequence:GTACCGGAGTCTCAGACAACCTACTATGCTCGAGCATAGTAGGTTGTCTGAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139302.1-1302s21c1
Sequence:CCGGGCCCGTCATTCAGCTATTAAACTCGAGTTTAATAGCTGAATGACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-602s21c1
Sequence:CCGGTCAGGAGACTAGACCTCGTAACTCGAGTTACGAGGTCTAGTCTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-749s21c1
Sequence:CCGGGATCAGCAGTACTCATGTGAACTCGAGTTCACATGAGTACTGCTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-237s21c1
Sequence:CCGGCGAGTGGAGGAGTTCCTATATCTCGAGATATAGGAACTCCTCCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-849s21c1
Sequence:GTACCGGCAGAAACAGCTAGGCAGATTTCTCGAGAAATCTGCCTAGCTGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-1302s1c1
Sequence:CCGGGCCCGTCATTCAGCTATTAAACTCGAGTTTAATAGCTGAATGACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-237s1c1
Sequence:CCGGCGAGTGGAGGAGTTCCTATATCTCGAGATATAGGAACTCCTCCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-602s1c1
Sequence:CCGGTCAGGAGACTAGACCTCGTAACTCGAGTTACGAGGTCTAGTCTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-749s1c1
Sequence:CCGGGATCAGCAGTACTCATGTGAACTCGAGTTCACATGAGTACTGCTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-604s1c1
Sequence:CCGGAGGAGACTAGACCTCGTAATTCTCGAGAATTACGAGGTCTAGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139302
VALIDATED
SH3GLB2 MISSION shRNA shRNA Plasmid DNA
SH3-domain GRB2-like endophilin B2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-799s21c1
Sequence:GTACCGGAGTCTCAGACAACCTACTATGCTCGAGCATAGTAGGTTGTCTGAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139302.1-1302s21c1
Sequence:CCGGGCCCGTCATTCAGCTATTAAACTCGAGTTTAATAGCTGAATGACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-602s21c1
Sequence:CCGGTCAGGAGACTAGACCTCGTAACTCGAGTTACGAGGTCTAGTCTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-749s21c1
Sequence:CCGGGATCAGCAGTACTCATGTGAACTCGAGTTCACATGAGTACTGCTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-237s21c1
Sequence:CCGGCGAGTGGAGGAGTTCCTATATCTCGAGATATAGGAACTCCTCCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-849s21c1
Sequence:GTACCGGCAGAAACAGCTAGGCAGATTTCTCGAGAAATCTGCCTAGCTGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-1302s1c1
Sequence:CCGGGCCCGTCATTCAGCTATTAAACTCGAGTTTAATAGCTGAATGACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-237s1c1
Sequence:CCGGCGAGTGGAGGAGTTCCTATATCTCGAGATATAGGAACTCCTCCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-602s1c1
Sequence:CCGGTCAGGAGACTAGACCTCGTAACTCGAGTTACGAGGTCTAGTCTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-749s1c1
Sequence:CCGGGATCAGCAGTACTCATGTGAACTCGAGTTCACATGAGTACTGCTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-604s1c1
Sequence:CCGGAGGAGACTAGACCTCGTAATTCTCGAGAATTACGAGGTCTAGTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139302
VALIDATED
SH3GLB2 MISSION shRNA Lentiviral Transduction Particles
SH3-domain GRB2-like endophilin B2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-799s21c1
Sequence:GTACCGGAGTCTCAGACAACCTACTATGCTCGAGCATAGTAGGTTGTCTGAGACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139302.1-1302s21c1
Sequence:CCGGGCCCGTCATTCAGCTATTAAACTCGAGTTTAATAGCTGAATGACGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-602s21c1
Sequence:CCGGTCAGGAGACTAGACCTCGTAACTCGAGTTACGAGGTCTAGTCTCCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-749s21c1
Sequence:CCGGGATCAGCAGTACTCATGTGAACTCGAGTTCACATGAGTACTGCTGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-237s21c1
Sequence:CCGGCGAGTGGAGGAGTTCCTATATCTCGAGATATAGGAACTCCTCCACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139302.1-849s21c1
Sequence:GTACCGGCAGAAACAGCTAGGCAGATTTCTCGAGAAATCTGCCTAGCTGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-1302s1c1
Sequence:CCGGGCCCGTCATTCAGCTATTAAACTCGAGTTTAATAGCTGAATGACGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-237s1c1
Sequence:CCGGCGAGTGGAGGAGTTCCTATATCTCGAGATATAGGAACTCCTCCACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-602s1c1
Sequence:CCGGTCAGGAGACTAGACCTCGTAACTCGAGTTACGAGGTCTAGTCTCCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-749s1c1
Sequence:CCGGGATCAGCAGTACTCATGTGAACTCGAGTTCACATGAGTACTGCTGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139302.1-604s1c1
Sequence:CCGGAGGAGACTAGACCTCGTAATTCTCGAGAATTACGAGGTCTAGTCTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020145
VALIDATED
SH3GLB2 MISSION shRNA Bacterial Glycerol Stock
SH3-domain GRB2-like endophilin B2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000160383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020145.2-1395s1c1
Sequence:CCGGCCACTTAACTTGTTTGTTGGTCTCGAGACCAACAAACAAGTTAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-739s1c1
Sequence:CCGGGTAATTACATTCTCTCGGCCACTCGAGTGGCCGAGAGAATGTAATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-773s1c1
Sequence:CCGGCTGGAATGATGAAGTGGACAACTCGAGTTGTCCACTTCATCATTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-714s1c1
Sequence:CCGGCCTGACTTTCAGGAGACTAGACTCGAGTCTAGTCTCCTGAAAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020145.2-1298s21c1
Sequence:CCGGCAAGGTCCCTGTCACCTACTTCTCGAGAAGTAGGTGACAGGGACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020145.2-870s21c1
Sequence:CCGGATCAGTAGCACTCACGTGAACCTCGAGGTTCACGTGAGTGCTACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020145.2-244s21c1
Sequence:CCGGCTGAGCTTGATGCCCACTTTGCTCGAGCAAAGTGGGCATCAAGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-914s1c1
Sequence:CCGGCGTCAAGTCTCAGACAACCTACTCGAGTAGGTTGTCTGAGACTTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020145.2-917s1c1
Sequence:CCGGCAAGTCTCAGACAACCTACTACTCGAGTAGTAGGTTGTCTGAGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-476s1c1
Sequence:CCGGCTATGGGAAGACACTGATCAACTCGAGTTGATCAGTGTCTTCCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020145.2-725s21c1
Sequence:CCGGGGAGACTAGACCTCGTAATTACTCGAGTAATTACGAGGTCTAGTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020145.2-1825s21c1
Sequence:CCGGAGCAGCATCTTCCGGTGCTATCTCGAGATAGCACCGGAAGATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020145.2-290s1c1
Sequence:CCGGCACCAAGAACTGGACAGAGAACTCGAGTTCTCTGTCCAGTTCTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-246s1c1
Sequence:CCGGGAGCTTGATGCCCACTTTGAACTCGAGTTCAAAGTGGGCATCAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020145
VALIDATED
SH3GLB2 MISSION shRNA shRNA Plasmid DNA
SH3-domain GRB2-like endophilin B2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000160383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020145.2-1395s1c1
Sequence:CCGGCCACTTAACTTGTTTGTTGGTCTCGAGACCAACAAACAAGTTAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-739s1c1
Sequence:CCGGGTAATTACATTCTCTCGGCCACTCGAGTGGCCGAGAGAATGTAATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-773s1c1
Sequence:CCGGCTGGAATGATGAAGTGGACAACTCGAGTTGTCCACTTCATCATTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-714s1c1
Sequence:CCGGCCTGACTTTCAGGAGACTAGACTCGAGTCTAGTCTCCTGAAAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020145.2-1298s21c1
Sequence:CCGGCAAGGTCCCTGTCACCTACTTCTCGAGAAGTAGGTGACAGGGACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020145.2-870s21c1
Sequence:CCGGATCAGTAGCACTCACGTGAACCTCGAGGTTCACGTGAGTGCTACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020145.2-244s21c1
Sequence:CCGGCTGAGCTTGATGCCCACTTTGCTCGAGCAAAGTGGGCATCAAGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-914s1c1
Sequence:CCGGCGTCAAGTCTCAGACAACCTACTCGAGTAGGTTGTCTGAGACTTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020145.2-917s1c1
Sequence:CCGGCAAGTCTCAGACAACCTACTACTCGAGTAGTAGGTTGTCTGAGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-476s1c1
Sequence:CCGGCTATGGGAAGACACTGATCAACTCGAGTTGATCAGTGTCTTCCCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020145.2-725s21c1
Sequence:CCGGGGAGACTAGACCTCGTAATTACTCGAGTAATTACGAGGTCTAGTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020145.2-1825s21c1
Sequence:CCGGAGCAGCATCTTCCGGTGCTATCTCGAGATAGCACCGGAAGATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020145.2-290s1c1
Sequence:CCGGCACCAAGAACTGGACAGAGAACTCGAGTTCTCTGTCCAGTTCTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-246s1c1
Sequence:CCGGGAGCTTGATGCCCACTTTGAACTCGAGTTCAAAGTGGGCATCAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020145
VALIDATED
SH3GLB2 MISSION shRNA Lentiviral Transduction Particles
SH3-domain GRB2-like endophilin B2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000160383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020145.2-1395s1c1
Sequence:CCGGCCACTTAACTTGTTTGTTGGTCTCGAGACCAACAAACAAGTTAAGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-739s1c1
Sequence:CCGGGTAATTACATTCTCTCGGCCACTCGAGTGGCCGAGAGAATGTAATTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-773s1c1
Sequence:CCGGCTGGAATGATGAAGTGGACAACTCGAGTTGTCCACTTCATCATTCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-714s1c1
Sequence:CCGGCCTGACTTTCAGGAGACTAGACTCGAGTCTAGTCTCCTGAAAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020145.2-1298s21c1
Sequence:CCGGCAAGGTCCCTGTCACCTACTTCTCGAGAAGTAGGTGACAGGGACCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020145.2-870s21c1
Sequence:CCGGATCAGTAGCACTCACGTGAACCTCGAGGTTCACGTGAGTGCTACTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020145.2-244s21c1
Sequence:CCGGCTGAGCTTGATGCCCACTTTGCTCGAGCAAAGTGGGCATCAAGCTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-914s1c1
Sequence:CCGGCGTCAAGTCTCAGACAACCTACTCGAGTAGGTTGTCTGAGACTTGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020145.2-917s1c1
Sequence:CCGGCAAGTCTCAGACAACCTACTACTCGAGTAGTAGGTTGTCTGAGACTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-476s1c1
Sequence:CCGGCTATGGGAAGACACTGATCAACTCGAGTTGATCAGTGTCTTCCCATAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020145.2-725s21c1
Sequence:CCGGGGAGACTAGACCTCGTAATTACTCGAGTAATTACGAGGTCTAGTCTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020145.2-1825s21c1
Sequence:CCGGAGCAGCATCTTCCGGTGCTATCTCGAGATAGCACCGGAAGATGCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020145.2-290s1c1
Sequence:CCGGCACCAAGAACTGGACAGAGAACTCGAGTTCTCTGTCCAGTTCTTGGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020145.2-246s1c1
Sequence:CCGGGAGCTTGATGCCCACTTTGAACTCGAGTTCAAAGTGGGCATCAAGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)