EMAIL THIS PAGE TO A FRIEND

SH3KBP1

SH3-domain kinase binding protein 1

125 Gene Product Result for
Synonyms: CD2BP3 CIN85 GIG10 HSB-1 HSB1 MIG18
Gene ID:
Human(30011) Summary: This gene encodes an adapter protein that contains three N-terminal Src homology domains, a proline rich region and a C-terminal coiled-coil domain. The encoded protein facilitates protein-protein interactions and has been implicated in numerous cellular processes including apoptosis, cytoskeletal rearrangement, cell adhesion and in the regulation of clathrin-dependent endocytosis. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(58194) SH3-domain kinase binding protein 1
Rat(84357) SH3-domain kinase binding protein 1
Zebrafish(793623) SH3-domain kinase binding protein 1
Horse(100058644) SH3-domain kinase binding protein 1
domestic cat(101081024) SH3-domain kinase binding protein 1
chicken(418608) SH3-domain kinase binding protein 1
dog(612797) SH3-domain kinase binding protein 1
domestic guinea pig(100720414) SH3-domain kinase binding protein 1
naked mole-rat(101717745) SH3-domain kinase binding protein 1
Domestic Rabbit(100357864) SH3-domain kinase binding protein 1
cow(510489) SH3-domain kinase binding protein 1
sheep(101110388) SH3-domain kinase binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031892 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057491 MISSION® esiRNA esiRNA human SH3KBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024666 Rosetta Predictions human pricing
NM_031892 Rosetta Predictions human pricing
NM_053360 Rosetta Predictions rat pricing
NM_021389 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024757 predicted 703
2 SASI_Hs02_00307221 predicted 1067
3 SASI_Hs01_00024759 predicted 629
4 SASI_Hs01_00024760 predicted 476
5 SASI_Hs01_00024761 predicted 1856
6 SASI_Hs01_00024763 predicted 1929
7 SASI_Hs01_00024764 predicted 2048
8 SASI_Hs02_00307222 predicted 624
9 SASI_Hs02_00307223 predicted 1914
10 SASI_Hs02_00307224 predicted 1834
11 SASI_Hs01_00024758 predicted 1336
12 SASI_Hs01_00024762 predicted 1377
13 SASI_Hs01_00024765 predicted 590
14 SASI_Hs01_00024766 predicted 1506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235951 predicted 1021
2 SASI_Hs02_00359000 predicted 1392
3 SASI_Hs01_00235953 predicted 955
4 SASI_Hs01_00235954 predicted 803
5 SASI_Hs01_00235955 predicted 2184
6 SASI_Hs01_00235957 predicted 2253
7 SASI_Hs01_00235958 predicted 2369
8 SASI_Hs02_00359001 predicted 954
9 SASI_Hs02_00359002 predicted 2241
10 SASI_Hs02_00359003 predicted 2159
11 SASI_Hs01_00235952 predicted 1664
12 SASI_Hs01_00235956 predicted 1697
13 SASI_Hs01_00235959 predicted 906
14 SASI_Hs01_00235960 predicted 1831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121069 predicted 1010
2 SASI_Rn01_00121070 predicted 1479
3 SASI_Rn01_00121071 predicted 1641
4 SASI_Rn01_00121072 predicted 1845
5 SASI_Rn01_00121073 predicted 1826
6 SASI_Rn01_00121074 predicted 1874
7 SASI_Rn01_00121075 predicted 1773
8 SASI_Rn01_00121077 predicted 1067
9 SASI_Rn02_00265834 predicted 1882
10 SASI_Rn02_00265835 predicted 1080
11 SASI_Rn01_00121068 predicted 1387
12 SASI_Rn01_00121076 predicted 1849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190374 predicted 1352
2 SASI_Mm01_00190376 predicted 1884
3 SASI_Mm01_00190378 predicted 1534
4 SASI_Mm02_00325984 predicted 1973
5 SASI_Mm01_00190379 predicted 1868
6 SASI_Mm01_00190380 predicted 1193
7 SASI_Mm01_00190381 predicted 1945
8 SASI_Mm01_00190383 predicted 715
9 SASI_Mm02_00325985 predicted 768
10 SASI_Mm02_00325986 predicted 1930
11 SASI_Mm01_00190375 predicted 1388
12 SASI_Mm01_00190377 predicted 491
13 SASI_Mm01_00190382 predicted 1593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021389
VALIDATED
SH3KBP1 MISSION shRNA Bacterial Glycerol Stock
SH3-domain kinase binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021389.3-2535s1c1
Sequence:CCGGCCCACCACTCTAAGAGAAATTCTCGAGAATTTCTCTTAGAGTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021389.3-1565s1c1
Sequence:CCGGCGTGTCAAAGAAGACTTCCAACTCGAGTTGGAAGTCTTCTTTGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021389.3-203s1c1
Sequence:CCGGGCACGATGTATCCAGTGGAAACTCGAGTTTCCACTGGATACATCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021389.3-1521s1c1
Sequence:CCGGGAAGATAAAGAGGAACACATTCTCGAGAATGTGTTCCTCTTTATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021389.3-135s1c1
Sequence:CCGGCCTGAGAGTGAAATAAAGAAACTCGAGTTTCTTTATTTCACTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021389.5-952s21c1
Sequence:CCGGAGTTACTTCCATCGGACTTTGCTCGAGCAAAGTCCGATGGAAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021389.5-1565s21c1
Sequence:CCGGCGTGTCAAAGAAGACTTCCAACTCGAGTTGGAAGTCTTCTTTGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021389.5-2535s21c1
Sequence:CCGGCCCACCACTCTAAGAGAAATTCTCGAGAATTTCTCTTAGAGTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021389.5-203s21c1
Sequence:CCGGGCACGATGTATCCAGTGGAAACTCGAGTTTCCACTGGATACATCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021389.5-1521s21c1
Sequence:CCGGGAAGATAAAGAGGAACACATTCTCGAGAATGTGTTCCTCTTTATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021389
VALIDATED
SH3KBP1 MISSION shRNA shRNA Plasmid DNA
SH3-domain kinase binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021389.3-2535s1c1
Sequence:CCGGCCCACCACTCTAAGAGAAATTCTCGAGAATTTCTCTTAGAGTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021389.3-1565s1c1
Sequence:CCGGCGTGTCAAAGAAGACTTCCAACTCGAGTTGGAAGTCTTCTTTGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021389.3-203s1c1
Sequence:CCGGGCACGATGTATCCAGTGGAAACTCGAGTTTCCACTGGATACATCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021389.3-1521s1c1
Sequence:CCGGGAAGATAAAGAGGAACACATTCTCGAGAATGTGTTCCTCTTTATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021389.3-135s1c1
Sequence:CCGGCCTGAGAGTGAAATAAAGAAACTCGAGTTTCTTTATTTCACTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021389.5-952s21c1
Sequence:CCGGAGTTACTTCCATCGGACTTTGCTCGAGCAAAGTCCGATGGAAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021389.5-1565s21c1
Sequence:CCGGCGTGTCAAAGAAGACTTCCAACTCGAGTTGGAAGTCTTCTTTGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021389.5-2535s21c1
Sequence:CCGGCCCACCACTCTAAGAGAAATTCTCGAGAATTTCTCTTAGAGTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021389.5-203s21c1
Sequence:CCGGGCACGATGTATCCAGTGGAAACTCGAGTTTCCACTGGATACATCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021389.5-1521s21c1
Sequence:CCGGGAAGATAAAGAGGAACACATTCTCGAGAATGTGTTCCTCTTTATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021389
VALIDATED
SH3KBP1 MISSION shRNA Lentiviral Transduction Particles
SH3-domain kinase binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021389.3-2535s1c1
Sequence:CCGGCCCACCACTCTAAGAGAAATTCTCGAGAATTTCTCTTAGAGTGGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021389.3-1565s1c1
Sequence:CCGGCGTGTCAAAGAAGACTTCCAACTCGAGTTGGAAGTCTTCTTTGACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021389.3-203s1c1
Sequence:CCGGGCACGATGTATCCAGTGGAAACTCGAGTTTCCACTGGATACATCGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021389.3-1521s1c1
Sequence:CCGGGAAGATAAAGAGGAACACATTCTCGAGAATGTGTTCCTCTTTATCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021389.3-135s1c1
Sequence:CCGGCCTGAGAGTGAAATAAAGAAACTCGAGTTTCTTTATTTCACTCTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021389.5-952s21c1
Sequence:CCGGAGTTACTTCCATCGGACTTTGCTCGAGCAAAGTCCGATGGAAGTAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021389.5-1565s21c1
Sequence:CCGGCGTGTCAAAGAAGACTTCCAACTCGAGTTGGAAGTCTTCTTTGACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021389.5-2535s21c1
Sequence:CCGGCCCACCACTCTAAGAGAAATTCTCGAGAATTTCTCTTAGAGTGGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021389.5-203s21c1
Sequence:CCGGGCACGATGTATCCAGTGGAAACTCGAGTTTCCACTGGATACATCGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021389.5-1521s21c1
Sequence:CCGGGAAGATAAAGAGGAACACATTCTCGAGAATGTGTTCCTCTTTATCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031892
VALIDATED
SH3KBP1 MISSION shRNA Bacterial Glycerol Stock
SH3-domain kinase binding protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031892.2-1287s21c1
Sequence:CCGGAGTTACTTCCACCGGACTTTGCTCGAGCAAAGTCCGGTGGAAGTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031892.2-370s21c1
Sequence:CCGGGACGATCAGCGTGGGTGAAATCTCGAGATTTCACCCACGCTGATCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031892.2-672s21c1
Sequence:CCGGTGAAAGTTGGCGACATCATAGCTCGAGCTATGATGTCGCCAACTTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-2435s1c1
Sequence:CCGGCACAACACAAATTCCATCCAACTCGAGTTGGATGGAATTTGTGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-1775s1c1
Sequence:CCGGCCCTCACATCTTCATCCCTTTCTCGAGAAAGGGATGAAGATGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-2175s1c1
Sequence:CCGGCCAGCAGAAACGAGAGATTAACTCGAGTTAATCTCTCGTTTCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-1082s1c1
Sequence:CCGGGCAGGACAAAGAGCAAGGATTCTCGAGAATCCTTGCTCTTTGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-795s1c1
Sequence:CCGGGCAGCTATCCAAGTCAAGTTTCTCGAGAAACTTGACTTGGATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031892
VALIDATED
SH3KBP1 MISSION shRNA shRNA Plasmid DNA
SH3-domain kinase binding protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031892.2-1287s21c1
Sequence:CCGGAGTTACTTCCACCGGACTTTGCTCGAGCAAAGTCCGGTGGAAGTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031892.2-370s21c1
Sequence:CCGGGACGATCAGCGTGGGTGAAATCTCGAGATTTCACCCACGCTGATCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031892.2-672s21c1
Sequence:CCGGTGAAAGTTGGCGACATCATAGCTCGAGCTATGATGTCGCCAACTTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-2435s1c1
Sequence:CCGGCACAACACAAATTCCATCCAACTCGAGTTGGATGGAATTTGTGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-1775s1c1
Sequence:CCGGCCCTCACATCTTCATCCCTTTCTCGAGAAAGGGATGAAGATGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-2175s1c1
Sequence:CCGGCCAGCAGAAACGAGAGATTAACTCGAGTTAATCTCTCGTTTCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-1082s1c1
Sequence:CCGGGCAGGACAAAGAGCAAGGATTCTCGAGAATCCTTGCTCTTTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-795s1c1
Sequence:CCGGGCAGCTATCCAAGTCAAGTTTCTCGAGAAACTTGACTTGGATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031892
VALIDATED
SH3KBP1 MISSION shRNA Lentiviral Transduction Particles
SH3-domain kinase binding protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031892.2-1287s21c1
Sequence:CCGGAGTTACTTCCACCGGACTTTGCTCGAGCAAAGTCCGGTGGAAGTAACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031892.2-370s21c1
Sequence:CCGGGACGATCAGCGTGGGTGAAATCTCGAGATTTCACCCACGCTGATCGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031892.2-672s21c1
Sequence:CCGGTGAAAGTTGGCGACATCATAGCTCGAGCTATGATGTCGCCAACTTTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-2435s1c1
Sequence:CCGGCACAACACAAATTCCATCCAACTCGAGTTGGATGGAATTTGTGTTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-1775s1c1
Sequence:CCGGCCCTCACATCTTCATCCCTTTCTCGAGAAAGGGATGAAGATGTGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-2175s1c1
Sequence:CCGGCCAGCAGAAACGAGAGATTAACTCGAGTTAATCTCTCGTTTCTGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-1082s1c1
Sequence:CCGGGCAGGACAAAGAGCAAGGATTCTCGAGAATCCTTGCTCTTTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031892.1-795s1c1
Sequence:CCGGGCAGCTATCCAAGTCAAGTTTCTCGAGAAACTTGACTTGGATAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)