EMAIL THIS PAGE TO A FRIEND

SH3PXD2B

SH3 and PX domains 2B

100 Gene Product Result for
Synonyms: FAD49 FTHS HOFI KIAA1295 TKS4 TSK4
UniProtKB ID: A1X283, B6F0V2, Q9P2Q1
Gene ID:
Human(285590) Summary: This gene encodes an adapter protein that is characterized by a PX domain and four Src homology 3 domains. The encoded protein is required for podosome formation and is involved in cell adhesion and migration of numerous cell types. Mutations in this gene are the cause of Frank-ter Haar syndrome. [provided by RefSeq, Sep 2010]
Mouse(268396) SH3 and PX domains 2B
Zebrafish(553242) SH3 and PX domains 2B
chicken(427625) SH3 and PX domains 2B
dog(489119) SH3 and PX domains 2B
Horse(100069899) SH3 and PX domains 2B
domestic cat(101093915) SH3 and PX domains 2B
domestic guinea pig(100717110) SH3 and PX domains 2B
naked mole-rat(101698402) SH3 and PX domains 2B
Domestic Rabbit(100359114) SH3 and PX domains 2B
cow(518356) SH3 and PX domains 2B
sheep(101106034) SH3 and PX domains 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036471 Anti-SH3PXD2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017995 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177364 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177364 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177364 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU070071 MISSION® esiRNA esiRNA targeting mouse Sh3pxd2b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017995 Rosetta Predictions human pricing
NM_177364 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197359 predicted 1737
2 SASI_Hs01_00197360 predicted 1178
3 SASI_Hs02_00306881 predicted 446
4 SASI_Hs01_00197361 predicted 2744
5 SASI_Hs02_00306882 predicted 2957
6 SASI_Hs01_00197363 predicted 2940
7 SASI_Hs01_00197364 predicted 439
8 SASI_Hs01_00197365 predicted 451
9 SASI_Hs01_00197366 predicted 2865
10 SASI_Hs02_00306883 predicted 2788
11 SASI_Hs01_00197358 predicted 2885
12 SASI_Hs01_00197362 predicted 1386
13 SASI_Hs01_00197367 predicted 2798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156573 predicted 2038
2 SASI_Mm01_00156574 predicted 347
3 SASI_Mm01_00156575 predicted 1647
4 SASI_Mm01_00156576 predicted 1270
5 SASI_Mm01_00156577 predicted 2094
6 SASI_Mm01_00156578 predicted 2869
7 SASI_Mm01_00156579 predicted 1742
8 SASI_Mm01_00156580 predicted 2309
9 SASI_Mm01_00156581 predicted 2854
10 SASI_Mm01_00156582 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017995
VALIDATED
SH3PXD2B MISSION shRNA Bacterial Glycerol Stock
SH3 and PX domains 2B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000129568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001017995.1-2375s1c1
Sequence:CCGGCCACAGATCCTGTGTCTAAGACTCGAGTCTTAGACACAGGATCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001017995.1-7292s1c1
Sequence:CCGGCCAGGCTTACATCAGCAATAACTCGAGTTATTGCTGATGTAAGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001017995.1-404s1c1
Sequence:CCGGGTAAGATTCTCTTCAGACGAACTCGAGTTCGTCTGAAGAGAATCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001017995.1-231s1c1
Sequence:CCGGGCCCAACAAGCATTATGTCTACTCGAGTAGACATAATGCTTGTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017995
VALIDATED
SH3PXD2B MISSION shRNA shRNA Plasmid DNA
SH3 and PX domains 2B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000129568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001017995.1-2375s1c1
Sequence:CCGGCCACAGATCCTGTGTCTAAGACTCGAGTCTTAGACACAGGATCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001017995.1-7292s1c1
Sequence:CCGGCCAGGCTTACATCAGCAATAACTCGAGTTATTGCTGATGTAAGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001017995.1-404s1c1
Sequence:CCGGGTAAGATTCTCTTCAGACGAACTCGAGTTCGTCTGAAGAGAATCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001017995.1-231s1c1
Sequence:CCGGGCCCAACAAGCATTATGTCTACTCGAGTAGACATAATGCTTGTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017995
VALIDATED
SH3PXD2B MISSION shRNA Lentiviral Transduction Particles
SH3 and PX domains 2B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000129568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001017995.1-2375s1c1
Sequence:CCGGCCACAGATCCTGTGTCTAAGACTCGAGTCTTAGACACAGGATCTGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001017995.1-7292s1c1
Sequence:CCGGCCAGGCTTACATCAGCAATAACTCGAGTTATTGCTGATGTAAGCCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001017995.1-404s1c1
Sequence:CCGGGTAAGATTCTCTTCAGACGAACTCGAGTTCGTCTGAAGAGAATCTTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001017995.1-231s1c1
Sequence:CCGGGCCCAACAAGCATTATGTCTACTCGAGTAGACATAATGCTTGTTGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177364
VALIDATED
SH3PXD2B MISSION shRNA Bacterial Glycerol Stock
SH3 and PX domains 2B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177364.3-6850s1c1
Sequence:CCGGCCAGGCTTATTACAGCAATAACTCGAGTTATTGCTGTAATAAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177364.3-1745s1c1
Sequence:CCGGCCCTGGCATGATATTGCCAATCTCGAGATTGGCAATATCATGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177364.3-486s1c1
Sequence:CCGGGAGCATATTGGGAAGAAGAAACTCGAGTTTCTTCTTCCCAATATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177364.3-1085s1c1
Sequence:CCGGCGTTAAGCAGAGATCACCAAACTCGAGTTTGGTGATCTCTGCTTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177364.3-2649s1c1
Sequence:CCGGGCCAACTTTGAAGGAGATGAACTCGAGTTCATCTCCTTCAAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177364.3-3129s21c1
Sequence:CCGGGACCACCCTCAATGCTCAATTCTCGAGAATTGAGCATTGAGGGTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177364.3-2096s21c1
Sequence:CCGGGTCTCAAGAGAAAGCCTTATTCTCGAGAATAAGGCTTTCTCTTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177364.3-2042s21c1
Sequence:CCGGGAGTGAAGACCACGTGGATATCTCGAGATATCCACGTGGTCTTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177364.3-783s21c1
Sequence:CCGGGCTCGTGACCAGGATGAAATGCTCGAGCATTTCATCCTGGTCACGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177364.3-289s21c1
Sequence:CCGGAGCAGAGGATCATTCCATTTCCTCGAGGAAATGGAATGATCCTCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177364
VALIDATED
SH3PXD2B MISSION shRNA shRNA Plasmid DNA
SH3 and PX domains 2B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177364.3-6850s1c1
Sequence:CCGGCCAGGCTTATTACAGCAATAACTCGAGTTATTGCTGTAATAAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177364.3-1745s1c1
Sequence:CCGGCCCTGGCATGATATTGCCAATCTCGAGATTGGCAATATCATGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177364.3-486s1c1
Sequence:CCGGGAGCATATTGGGAAGAAGAAACTCGAGTTTCTTCTTCCCAATATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177364.3-1085s1c1
Sequence:CCGGCGTTAAGCAGAGATCACCAAACTCGAGTTTGGTGATCTCTGCTTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177364.3-2649s1c1
Sequence:CCGGGCCAACTTTGAAGGAGATGAACTCGAGTTCATCTCCTTCAAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177364.3-3129s21c1
Sequence:CCGGGACCACCCTCAATGCTCAATTCTCGAGAATTGAGCATTGAGGGTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177364.3-2096s21c1
Sequence:CCGGGTCTCAAGAGAAAGCCTTATTCTCGAGAATAAGGCTTTCTCTTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177364.3-2042s21c1
Sequence:CCGGGAGTGAAGACCACGTGGATATCTCGAGATATCCACGTGGTCTTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177364.3-783s21c1
Sequence:CCGGGCTCGTGACCAGGATGAAATGCTCGAGCATTTCATCCTGGTCACGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177364.3-289s21c1
Sequence:CCGGAGCAGAGGATCATTCCATTTCCTCGAGGAAATGGAATGATCCTCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177364
VALIDATED
SH3PXD2B MISSION shRNA Lentiviral Transduction Particles
SH3 and PX domains 2B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177364.3-6850s1c1
Sequence:CCGGCCAGGCTTATTACAGCAATAACTCGAGTTATTGCTGTAATAAGCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177364.3-1745s1c1
Sequence:CCGGCCCTGGCATGATATTGCCAATCTCGAGATTGGCAATATCATGCCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177364.3-486s1c1
Sequence:CCGGGAGCATATTGGGAAGAAGAAACTCGAGTTTCTTCTTCCCAATATGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177364.3-1085s1c1
Sequence:CCGGCGTTAAGCAGAGATCACCAAACTCGAGTTTGGTGATCTCTGCTTAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177364.3-2649s1c1
Sequence:CCGGGCCAACTTTGAAGGAGATGAACTCGAGTTCATCTCCTTCAAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177364.3-3129s21c1
Sequence:CCGGGACCACCCTCAATGCTCAATTCTCGAGAATTGAGCATTGAGGGTGGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177364.3-2096s21c1
Sequence:CCGGGTCTCAAGAGAAAGCCTTATTCTCGAGAATAAGGCTTTCTCTTGAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177364.3-2042s21c1
Sequence:CCGGGAGTGAAGACCACGTGGATATCTCGAGATATCCACGTGGTCTTCACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177364.3-783s21c1
Sequence:CCGGGCTCGTGACCAGGATGAAATGCTCGAGCATTTCATCCTGGTCACGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177364.3-289s21c1
Sequence:CCGGAGCAGAGGATCATTCCATTTCCTCGAGGAAATGGAATGATCCTCTGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)