EMAIL THIS PAGE TO A FRIEND

SH3RF1

SH3 domain containing ring finger 1

137 Gene Product Result for
Synonyms: POSH RNF142 SH3MD2
UniProtKB ID: Q7Z6J0, Q05BT2, Q8IW46, Q9HAM2, Q9P234
Gene ID:
Human(57630) Summary: This gene encodes a protein containing an N-terminus RING-finger, four SH3 domains, and a region implicated in binding of the Rho GTPase Rac. Via the RING-finger, the encoded protein has been shown to function as an ubiquitin-protein ligase involved in protein sorting at the trans-Golgi network. The encoded protein may also act as a scaffold for the c-Jun N-terminal kinase signaling pathway, facilitating the formation of a functional signaling module. [provided by RefSeq, Jul 2008]
Mouse(59009) SH3 domain containing ring finger 1
Rat(306417) SH3 domain containing ring finger 1
cow(528315) SH3 domain containing ring finger 1
sheep(101115008) SH3 domain containing ring finger 1
naked mole-rat(101702774) SH3 domain containing ring finger 1
domestic guinea pig(100728797) SH3 domain containing ring finger 1
Zebrafish(556523) SH3 domain containing ring finger 1
chicken(422434) SH3 domain containing ring finger 1
dog(612744) SH3 domain containing ring finger 1
Horse(100061339) SH3 domain containing ring finger 1
domestic cat(101100383) SH3 domain containing ring finger 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020870 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020870 Rosetta Predictions human pricing
NM_198764 Rosetta Predictions rat pricing
NM_021506 Rosetta Predictions mouse pricing
NM_198678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053885 predicted 935
2 SASI_Hs01_00053886 predicted 1089
3 SASI_Hs01_00053887 predicted 1843
4 SASI_Hs01_00053888 predicted 971
5 SASI_Hs01_00053889 predicted 619
6 SASI_Hs01_00053890 predicted 1856
7 SASI_Hs01_00053891 predicted 972
8 SASI_Hs02_00354166 predicted 1714
9 SASI_Hs01_00053892 predicted 1874
10 SASI_Hs01_00053893 predicted 856
11 SASI_Hs01_00053894 predicted 1498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119885 predicted 600
2 SASI_Rn01_00119887 predicted 1525
3 SASI_Rn01_00119889 predicted 1596
4 SASI_Rn01_00119890 predicted 735
5 SASI_Rn01_00119891 predicted 600
6 SASI_Rn02_00270006 predicted 739
7 SASI_Rn01_00119892 predicted 553
8 SASI_Rn01_00119893 predicted 1546
9 SASI_Rn01_00119894 predicted 1761
10 SASI_Rn02_00270007 predicted 1563
11 SASI_Rn01_00119886 predicted 745
12 SASI_Rn01_00119888 predicted 2090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326219 predicted 1975
2 SASI_Mm02_00326220 predicted 1821
3 SASI_Mm01_00177440 predicted 2600
4 SASI_Mm01_00177441 predicted 377
5 SASI_Mm02_00326221 predicted 1030
6 SASI_Mm02_00326222 predicted 2874
7 SASI_Mm02_00326223 predicted 1820
8 SASI_Mm01_00177444 predicted 2881
9 SASI_Mm02_00326224 predicted 574
10 SASI_Mm02_00326225 predicted 1790
11 SASI_Mm01_00177438 predicted 942
12 SASI_Mm01_00177439 predicted 247
13 SASI_Mm01_00177442 predicted 2773
14 SASI_Mm01_00177443 predicted 2862
15 SASI_Mm01_00177445 predicted 1119
16 SASI_Mm01_00177446 predicted 210
17 SASI_Mm01_00177447 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162377 predicted 921
2 SASI_Mm01_00162378 predicted 309
3 SASI_Mm01_00162379 predicted 2477
4 SASI_Mm01_00162380 predicted 347
5 SASI_Mm01_00162381 predicted 2742
6 SASI_Mm01_00162382 predicted 2826
7 SASI_Mm01_00162383 predicted 2759
8 SASI_Mm01_00162384 predicted 1093
9 SASI_Mm01_00162385 predicted 274
10 SASI_Mm01_00162386 predicted 377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020870
SH3RF1 MISSION shRNA Bacterial Glycerol Stock
SH3 domain containing ring finger 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020870.3-3192s21c1
Sequence:CCGGTAGTCTGGATTCGGATGTATACTCGAGTATACATCCGAATCCAGACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-723s1c2
Sequence:CCGGCCCACCAACTTTGTGCAGATTCTCGAGAATCTGCACAAAGTTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020870.3-3292s21c1
Sequence:CCGGTGTTTACAAGGCTTAACTAATCTCGAGATTAGTTAAGCCTTGTAAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-3213s1c1
Sequence:CCGGGCAGAACTTGAACTTAAAGAACTCGAGTTCTTTAAGTTCAAGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-2017s1c1
Sequence:CCGGCCAGTGTGTATGTTGCTATATCTCGAGATATAGCAACATACACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-2049s1c1
Sequence:CCGGCCTCGGAAAGAGGATGAACTACTCGAGTAGTTCATCCTCTTTCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-482s1c1
Sequence:CCGGTGTGGCTAATTGTAGCTCAAACTCGAGTTTGAGCTACAATTAGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020870.3-451s21c1
Sequence:CCGGGGATCGTAGGTTCTCGAAATGCTCGAGCATTTCGAGAACCTACGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020870
SH3RF1 MISSION shRNA shRNA Plasmid DNA
SH3 domain containing ring finger 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020870.3-3192s21c1
Sequence:CCGGTAGTCTGGATTCGGATGTATACTCGAGTATACATCCGAATCCAGACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-723s1c2
Sequence:CCGGCCCACCAACTTTGTGCAGATTCTCGAGAATCTGCACAAAGTTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020870.3-3292s21c1
Sequence:CCGGTGTTTACAAGGCTTAACTAATCTCGAGATTAGTTAAGCCTTGTAAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-3213s1c1
Sequence:CCGGGCAGAACTTGAACTTAAAGAACTCGAGTTCTTTAAGTTCAAGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-2017s1c1
Sequence:CCGGCCAGTGTGTATGTTGCTATATCTCGAGATATAGCAACATACACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-2049s1c1
Sequence:CCGGCCTCGGAAAGAGGATGAACTACTCGAGTAGTTCATCCTCTTTCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-482s1c1
Sequence:CCGGTGTGGCTAATTGTAGCTCAAACTCGAGTTTGAGCTACAATTAGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020870.3-451s21c1
Sequence:CCGGGGATCGTAGGTTCTCGAAATGCTCGAGCATTTCGAGAACCTACGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020870
SH3RF1 MISSION shRNA Lentiviral Transduction Particles
SH3 domain containing ring finger 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020870.3-3192s21c1
Sequence:CCGGTAGTCTGGATTCGGATGTATACTCGAGTATACATCCGAATCCAGACTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-723s1c2
Sequence:CCGGCCCACCAACTTTGTGCAGATTCTCGAGAATCTGCACAAAGTTGGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020870.3-3292s21c1
Sequence:CCGGTGTTTACAAGGCTTAACTAATCTCGAGATTAGTTAAGCCTTGTAAACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-3213s1c1
Sequence:CCGGGCAGAACTTGAACTTAAAGAACTCGAGTTCTTTAAGTTCAAGTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-2017s1c1
Sequence:CCGGCCAGTGTGTATGTTGCTATATCTCGAGATATAGCAACATACACACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-2049s1c1
Sequence:CCGGCCTCGGAAAGAGGATGAACTACTCGAGTAGTTCATCCTCTTTCCGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020870.1-482s1c1
Sequence:CCGGTGTGGCTAATTGTAGCTCAAACTCGAGTTTGAGCTACAATTAGCCACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020870.3-451s21c1
Sequence:CCGGGGATCGTAGGTTCTCGAAATGCTCGAGCATTTCGAGAACCTACGATCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021506
VALIDATED
SH3RF1 MISSION shRNA Bacterial Glycerol Stock
SH3 domain containing ring finger 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021506.2-1813s21c1
Sequence:CCGGACGAATGCCTCCCAAGCTAAACTCGAGTTTAGCTTGGGAGGCATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021506.2-2815s21c1
Sequence:CCGGGCCGAACTTGAACTCAAGGAACTCGAGTTCCTTGAGTTCAAGTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021506.2-2983s21c1
Sequence:CCGGCGTGTGACTAAAGAGCACAAACTCGAGTTTGTGCTCTTTAGTCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021506.2-1346s21c1
Sequence:CCGGTAAGCACCACTGGGTTAATTGCTCGAGCAATTAACCCAGTGGTGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021506.1-2717s1c1
Sequence:CCGGGCCGAACTTGAACTCAAGGAACTCGAGTTCCTTGAGTTCAAGTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021506.1-2885s1c1
Sequence:CCGGCGTGTGACTAAAGAGCACAAACTCGAGTTTGTGCTCTTTAGTCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021506.1-578s1c1
Sequence:CCGGCCGTGTGCCAAAGCATTATATCTCGAGATATAATGCTTTGGCACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021506.1-1530s1c1
Sequence:CCGGCCAGTGTATATGTTGCTATATCTCGAGATATAGCAACATATACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021506.1-917s1c1
Sequence:CCGGCCAATTTCATACGTGGAGTTTCTCGAGAAACTCCACGTATGAAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021506.2-679s21c1
Sequence:CCGGCCGTGTGCCAAAGCATTATATCTCGAGATATAATGCTTTGGCACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021506
VALIDATED
SH3RF1 MISSION shRNA shRNA Plasmid DNA
SH3 domain containing ring finger 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021506.2-1813s21c1
Sequence:CCGGACGAATGCCTCCCAAGCTAAACTCGAGTTTAGCTTGGGAGGCATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021506.2-2815s21c1
Sequence:CCGGGCCGAACTTGAACTCAAGGAACTCGAGTTCCTTGAGTTCAAGTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021506.2-2983s21c1
Sequence:CCGGCGTGTGACTAAAGAGCACAAACTCGAGTTTGTGCTCTTTAGTCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021506.2-1346s21c1
Sequence:CCGGTAAGCACCACTGGGTTAATTGCTCGAGCAATTAACCCAGTGGTGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021506.1-2717s1c1
Sequence:CCGGGCCGAACTTGAACTCAAGGAACTCGAGTTCCTTGAGTTCAAGTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021506.1-2885s1c1
Sequence:CCGGCGTGTGACTAAAGAGCACAAACTCGAGTTTGTGCTCTTTAGTCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021506.1-578s1c1
Sequence:CCGGCCGTGTGCCAAAGCATTATATCTCGAGATATAATGCTTTGGCACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021506.1-1530s1c1
Sequence:CCGGCCAGTGTATATGTTGCTATATCTCGAGATATAGCAACATATACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021506.1-917s1c1
Sequence:CCGGCCAATTTCATACGTGGAGTTTCTCGAGAAACTCCACGTATGAAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021506.2-679s21c1
Sequence:CCGGCCGTGTGCCAAAGCATTATATCTCGAGATATAATGCTTTGGCACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021506
VALIDATED
SH3RF1 MISSION shRNA Lentiviral Transduction Particles
SH3 domain containing ring finger 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021506.2-1813s21c1
Sequence:CCGGACGAATGCCTCCCAAGCTAAACTCGAGTTTAGCTTGGGAGGCATTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021506.2-2815s21c1
Sequence:CCGGGCCGAACTTGAACTCAAGGAACTCGAGTTCCTTGAGTTCAAGTTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021506.2-2983s21c1
Sequence:CCGGCGTGTGACTAAAGAGCACAAACTCGAGTTTGTGCTCTTTAGTCACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021506.2-1346s21c1
Sequence:CCGGTAAGCACCACTGGGTTAATTGCTCGAGCAATTAACCCAGTGGTGCTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021506.1-2717s1c1
Sequence:CCGGGCCGAACTTGAACTCAAGGAACTCGAGTTCCTTGAGTTCAAGTTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021506.1-2885s1c1
Sequence:CCGGCGTGTGACTAAAGAGCACAAACTCGAGTTTGTGCTCTTTAGTCACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021506.1-578s1c1
Sequence:CCGGCCGTGTGCCAAAGCATTATATCTCGAGATATAATGCTTTGGCACACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021506.1-1530s1c1
Sequence:CCGGCCAGTGTATATGTTGCTATATCTCGAGATATAGCAACATATACACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021506.1-917s1c1
Sequence:CCGGCCAATTTCATACGTGGAGTTTCTCGAGAAACTCCACGTATGAAATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021506.2-679s21c1
Sequence:CCGGCCGTGTGCCAAAGCATTATATCTCGAGATATAATGCTTTGGCACACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)