EMAIL THIS PAGE TO A FRIEND

SH3TC1

SH3 domain and tetratricopeptide repeats 1

40 Gene Product Result for
UniProtKB ID: Q8TE82, Q4W5G5
Gene ID:
Mouse(231147) SH3 domain and tetratricopeptide repeats 1
Rat(305441) SH3 domain and tetratricopeptide repeats 1
Zebrafish(100535608) SH3 domain and tetratricopeptide repeats 1
chicken(422867) SH3 domain and tetratricopeptide repeats 1
Horse(100146376) SH3 domain and tetratricopeptide repeats 1
domestic cat(101089262) SH3 domain and tetratricopeptide repeats 1
dog(488788) SH3 domain and tetratricopeptide repeats 1
domestic guinea pig(100716405) SH3 domain and tetratricopeptide repeats 1
naked mole-rat(101718548) SH3 domain and tetratricopeptide repeats 1
cow(100300032) SH3 domain and tetratricopeptide repeats 1
sheep(101119138) SH3 domain and tetratricopeptide repeats 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018986 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018986 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018986 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018986 Rosetta Predictions human pricing
NM_001107226 Rosetta Predictions rat pricing
NM_194344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096594 predicted 3527
2 SASI_Hs02_00352482 predicted 663
3 SASI_Hs01_00096595 predicted 3972
4 SASI_Hs01_00096596 predicted 2333
5 SASI_Hs01_00096597 predicted 2236
6 SASI_Hs01_00096598 predicted 3852
7 SASI_Hs01_00096599 predicted 2281
8 SASI_Hs01_00096600 predicted 916
9 SASI_Hs01_00096601 predicted 3795
10 SASI_Hs01_00096602 predicted 3827
11 SASI_Hs01_00096603 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107226 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226755 predicted 273
2 SASI_Rn02_00226756 predicted 3792
3 SASI_Rn02_00226757 predicted 2085
4 SASI_Rn02_00226758 predicted 3355
5 SASI_Rn02_00226759 predicted 522
6 SASI_Rn02_00226760 predicted 3828
7 SASI_Rn02_00226761 predicted 3309
8 SASI_Rn02_00226762 predicted 3952
9 SASI_Rn02_00226763 predicted 3202
10 SASI_Rn02_00226764 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199697 predicted 2195
2 SASI_Mm01_00199698 predicted 4162
3 SASI_Mm01_00199699 predicted 977
4 SASI_Mm01_00199700 predicted 4284
5 SASI_Mm01_00199701 predicted 4127
6 SASI_Mm01_00199702 predicted 3655
7 SASI_Mm01_00199703 predicted 2695
8 SASI_Mm01_00199704 predicted 3408
9 SASI_Mm01_00199705 predicted 4218
10 SASI_Mm01_00199706 predicted 3638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194344
SH3TC1 MISSION shRNA Bacterial Glycerol Stock
SH3 domain and tetratricopeptide repeats 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.2-3662s1c1
Sequence:CCGGGAATGAGCTGGTGGACTTATACTCGAGTATAAGTCCACCAGCTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-3633s21c1
Sequence:CCGGGCAGGGAAGATCTACTATATCCTCGAGGATATAGTAGATCTTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.1-2331s1c1
Sequence:CCGGCCAGGAGTGTGTTATGATGAACTCGAGTTCATCATAACACACTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.1-1870s1c1
Sequence:CCGGGCTGACATTTATGGCCGGAAACTCGAGTTTCCGGCCATAAATGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.2-3633s1c1
Sequence:CCGGGCAGGGAAGATCTACTATATCCTCGAGGATATAGTAGATCTTCCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.2-2210s1c1
Sequence:CCGGCCTGACTACTGTGTACCTAAACTCGAGTTTAGGTACACAGTAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-806s21c1
Sequence:CCGGCCGGATCGTGGTGACATTTAACTCGAGTTAAATGTCACCACGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-4167s21c1
Sequence:CCGGTTTGATGCAGCTGGGTATTACCTCGAGGTAATACCCAGCTGCATCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-1247s21c1
Sequence:CCGGATGGGATCCCATCGATGAATCCTCGAGGATTCATCGATGGGATCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-3549s21c1
Sequence:CCGGTCGGCTCTGGATTACACTAAACTCGAGTTTAGTGTAATCCAGAGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194344
SH3TC1 MISSION shRNA shRNA Plasmid DNA
SH3 domain and tetratricopeptide repeats 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.2-3662s1c1
Sequence:CCGGGAATGAGCTGGTGGACTTATACTCGAGTATAAGTCCACCAGCTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-3633s21c1
Sequence:CCGGGCAGGGAAGATCTACTATATCCTCGAGGATATAGTAGATCTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.1-2331s1c1
Sequence:CCGGCCAGGAGTGTGTTATGATGAACTCGAGTTCATCATAACACACTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.1-1870s1c1
Sequence:CCGGGCTGACATTTATGGCCGGAAACTCGAGTTTCCGGCCATAAATGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.2-3633s1c1
Sequence:CCGGGCAGGGAAGATCTACTATATCCTCGAGGATATAGTAGATCTTCCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.2-2210s1c1
Sequence:CCGGCCTGACTACTGTGTACCTAAACTCGAGTTTAGGTACACAGTAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-806s21c1
Sequence:CCGGCCGGATCGTGGTGACATTTAACTCGAGTTAAATGTCACCACGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-4167s21c1
Sequence:CCGGTTTGATGCAGCTGGGTATTACCTCGAGGTAATACCCAGCTGCATCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-1247s21c1
Sequence:CCGGATGGGATCCCATCGATGAATCCTCGAGGATTCATCGATGGGATCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-3549s21c1
Sequence:CCGGTCGGCTCTGGATTACACTAAACTCGAGTTTAGTGTAATCCAGAGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194344
SH3TC1 MISSION shRNA Lentiviral Transduction Particles
SH3 domain and tetratricopeptide repeats 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.2-3662s1c1
Sequence:CCGGGAATGAGCTGGTGGACTTATACTCGAGTATAAGTCCACCAGCTCATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-3633s21c1
Sequence:CCGGGCAGGGAAGATCTACTATATCCTCGAGGATATAGTAGATCTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.1-2331s1c1
Sequence:CCGGCCAGGAGTGTGTTATGATGAACTCGAGTTCATCATAACACACTCCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.1-1870s1c1
Sequence:CCGGGCTGACATTTATGGCCGGAAACTCGAGTTTCCGGCCATAAATGTCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.2-3633s1c1
Sequence:CCGGGCAGGGAAGATCTACTATATCCTCGAGGATATAGTAGATCTTCCCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194344.2-2210s1c1
Sequence:CCGGCCTGACTACTGTGTACCTAAACTCGAGTTTAGGTACACAGTAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-806s21c1
Sequence:CCGGCCGGATCGTGGTGACATTTAACTCGAGTTAAATGTCACCACGATCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-4167s21c1
Sequence:CCGGTTTGATGCAGCTGGGTATTACCTCGAGGTAATACCCAGCTGCATCAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-1247s21c1
Sequence:CCGGATGGGATCCCATCGATGAATCCTCGAGGATTCATCGATGGGATCCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194344.2-3549s21c1
Sequence:CCGGTCGGCTCTGGATTACACTAAACTCGAGTTTAGTGTAATCCAGAGCCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018986
SH3TC1 MISSION shRNA Bacterial Glycerol Stock
SH3 domain and tetratricopeptide repeats 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-896s1c1
Sequence:CCGGCCATTTCATCAGTGGGCTCTTCTCGAGAAGAGCCCACTGATGAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018986.3-518s21c1
Sequence:CCGGCCGGATCGTGGTGACGTTTAACTCGAGTTAAACGTCACCACGATCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-3793s1c1
Sequence:CCGGCGGTGACATCATCTTCTACGACTCGAGTCGTAGAAGATGATGTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-3046s1c1
Sequence:CCGGCCACTTCTACAGCGCCGTCATCTCGAGATGACGGCGCTGTAGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-2350s1c1
Sequence:CCGGCCCTGCCCAAACTTCCCACTACTCGAGTAGTGGGAAGTTTGGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-1175s1c1
Sequence:CCGGTCCGAGTTGGAAAGTGCGATTCTCGAGAATCGCACTTTCCAACTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018986.3-3860s21c1
Sequence:CCGGGTTTGATGCAGCCGGGTACTACTCGAGTAGTACCCGGCTGCATCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018986
SH3TC1 MISSION shRNA shRNA Plasmid DNA
SH3 domain and tetratricopeptide repeats 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-896s1c1
Sequence:CCGGCCATTTCATCAGTGGGCTCTTCTCGAGAAGAGCCCACTGATGAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018986.3-518s21c1
Sequence:CCGGCCGGATCGTGGTGACGTTTAACTCGAGTTAAACGTCACCACGATCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-3793s1c1
Sequence:CCGGCGGTGACATCATCTTCTACGACTCGAGTCGTAGAAGATGATGTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-3046s1c1
Sequence:CCGGCCACTTCTACAGCGCCGTCATCTCGAGATGACGGCGCTGTAGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-2350s1c1
Sequence:CCGGCCCTGCCCAAACTTCCCACTACTCGAGTAGTGGGAAGTTTGGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-1175s1c1
Sequence:CCGGTCCGAGTTGGAAAGTGCGATTCTCGAGAATCGCACTTTCCAACTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018986.3-3860s21c1
Sequence:CCGGGTTTGATGCAGCCGGGTACTACTCGAGTAGTACCCGGCTGCATCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018986
SH3TC1 MISSION shRNA Lentiviral Transduction Particles
SH3 domain and tetratricopeptide repeats 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-896s1c1
Sequence:CCGGCCATTTCATCAGTGGGCTCTTCTCGAGAAGAGCCCACTGATGAAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018986.3-518s21c1
Sequence:CCGGCCGGATCGTGGTGACGTTTAACTCGAGTTAAACGTCACCACGATCCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-3793s1c1
Sequence:CCGGCGGTGACATCATCTTCTACGACTCGAGTCGTAGAAGATGATGTCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-3046s1c1
Sequence:CCGGCCACTTCTACAGCGCCGTCATCTCGAGATGACGGCGCTGTAGAAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-2350s1c1
Sequence:CCGGCCCTGCCCAAACTTCCCACTACTCGAGTAGTGGGAAGTTTGGGCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018986.2-1175s1c1
Sequence:CCGGTCCGAGTTGGAAAGTGCGATTCTCGAGAATCGCACTTTCCAACTCGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018986.3-3860s21c1
Sequence:CCGGGTTTGATGCAGCCGGGTACTACTCGAGTAGTACCCGGCTGCATCAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)