EMAIL THIS PAGE TO A FRIEND

SHANK1

SH3 and multiple ankyrin repeat domains 1

86 Gene Product Result for
Synonyms: SPANK-1 SSTRIP synamon
UniProtKB ID: Q9Y566, A8MXP5, B7WNY6, Q9NYW9
Gene ID:
Mouse(243961) SH3/ankyrin domain gene 1
Rat(78957) SH3 and multiple ankyrin repeat domains 1
domestic cat(101098420) SH3 and multiple ankyrin repeat domains 1
dog(484359) SH3 and multiple ankyrin repeat domains 1
cow(518970) SH3 and multiple ankyrin repeat domains 1
sheep(101118813) SH3 and multiple ankyrin repeat domains 1
naked mole-rat(101720175) SH3 and multiple ankyrin repeat domains 1
domestic guinea pig(100718466) SH3 and multiple ankyrin repeat domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016148 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001473991 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001473991 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001473991 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016148 Rosetta Predictions human pricing
NM_031751 Rosetta Predictions rat pricing
XM_001473991 Rosetta Predictions mouse pricing
XM_001474910 Rosetta Predictions mouse pricing
XM_001474925 Rosetta Predictions mouse pricing
XM_894241 Rosetta Predictions mouse pricing
XM_901401 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060364 predicted 685
2 SASI_Hs01_00060365 predicted 1173
3 SASI_Hs01_00060366 predicted 2697
4 SASI_Hs01_00060367 predicted 1895
5 SASI_Hs01_00060368 predicted 5849
6 SASI_Hs01_00060369 predicted 478
7 SASI_Hs01_00060370 predicted 1872
8 SASI_Hs01_00060371 predicted 222
9 SASI_Hs01_00060372 predicted 1950
10 SASI_Hs01_00060373 predicted 2467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048645 predicted 411
2 SASI_Rn02_00265164 predicted 966
3 SASI_Rn01_00048646 predicted 725
4 SASI_Rn01_00048647 predicted 3783
5 SASI_Rn01_00048648 predicted 5739
6 SASI_Rn01_00048649 predicted 620
7 SASI_Rn01_00048650 predicted 2714
8 SASI_Rn01_00048651 predicted 6396
9 SASI_Rn01_00048653 predicted 497
10 SASI_Rn02_00265165 predicted 6180
11 SASI_Rn01_00048652 predicted 1186
12 SASI_Rn01_00048654 predicted 6510
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00372222 predicted 5097
2 SASI_Mm02_00372223 predicted 276
3 SASI_Mm02_00372224 predicted 397
4 SASI_Mm02_00372225 predicted 308
5 SASI_Mm02_00372226 predicted 721
6 SASI_Mm02_00372227 predicted 536
7 SASI_Mm02_00372228 predicted 6384
8 SASI_Mm02_00372229 predicted 484
9 SASI_Mm02_00372230 predicted 3851
10 SASI_Mm02_00372231 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00378751 predicted 324
2 SASI_Mm02_00378752 predicted 1980
3 SASI_Mm02_00378753 predicted 234
4 SASI_Mm02_00378754 predicted 643
5 SASI_Mm02_00378755 predicted 1868
6 SASI_Mm02_00378756 predicted 6312
7 SASI_Mm02_00378757 predicted 2177
8 SASI_Mm02_00378758 predicted 1928
9 SASI_Mm02_00378759 predicted 1105
10 SASI_Mm02_00378760 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00378869 predicted 323
2 SASI_Mm02_00378870 predicted 1978
3 SASI_Mm02_00378871 predicted 230
4 SASI_Mm02_00378872 predicted 642
5 SASI_Mm02_00378873 predicted 1867
6 SASI_Mm02_00378874 predicted 6286
7 SASI_Mm02_00378875 predicted 2177
8 SASI_Mm02_00378876 predicted 1925
9 SASI_Mm02_00378877 predicted 1103
10 SASI_Mm02_00378878 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224228 predicted 606
2 SASI_Mm01_00224229 predicted 409
3 SASI_Mm01_00224230 predicted 314
4 SASI_Mm01_00224231 predicted 719
5 SASI_Mm01_00224232 predicted 1951
6 SASI_Mm01_00224233 predicted 6361
7 SASI_Mm01_00224234 predicted 2259
8 SASI_Mm01_00224235 predicted 2015
9 SASI_Mm01_00224236 predicted 496
10 SASI_Mm01_00224237 predicted 1927
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261033 predicted 334
2 SASI_Mm01_00261034 predicted 2038
3 SASI_Mm01_00261035 predicted 3007
4 SASI_Mm01_00261036 predicted 3212
5 SASI_Mm01_00261037 predicted 3237
6 SASI_Mm01_00261038 predicted 2861
7 SASI_Mm01_00261039 predicted 2906
8 SASI_Mm01_00261040 predicted 3080
9 SASI_Mm01_00261041 predicted 2227
10 SASI_Mm01_00261042 predicted 1457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016148
SHANK1 MISSION shRNA Bacterial Glycerol Stock
SH3 and multiple ankyrin repeat domains 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016148.2-6469s21c1
Sequence:CCGGCATCGACCGGGCTCTCAAATTCTCGAGAATTTGAGAGCCCGGTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-1139s1c1
Sequence:CCGGGATGTGAAGAACAACAACGGACTCGAGTCCGTTGTTGTTCTTCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-493s1c1
Sequence:CCGGCCGAGTTTACAAACAGACCAACTCGAGTTGGTCTGTTTGTAAACTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-556s1c1
Sequence:CCGGGTTGAAGAAGTTCCTGGAGTACTCGAGTACTCCAGGAACTTCTTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-2471s1c1
Sequence:CCGGGCTCTCAACAAACTGGACGAACTCGAGTTCGTCCAGTTTGTTGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-2458s1c1
Sequence:CCGGCGTGTATCAGATGGCTCTCAACTCGAGTTGAGAGCCATCTGATACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-492s1c1
Sequence:CCGGCCCGAGTTTACAAACAGACCACTCGAGTGGTCTGTTTGTAAACTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-633s1c1
Sequence:CCGGCCAATTACCATGACTCGGATTCTCGAGAATCCGAGTCATGGTAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-1952s1c1
Sequence:CCGGCCAAGCTTAATGGATGGGATTCTCGAGAATCCCATCCATTAAGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016148.2-1902s21c1
Sequence:CCGGAGAGACTCTTCCGGCATTATACTCGAGTATAATGCCGGAAGAGTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016148
SHANK1 MISSION shRNA shRNA Plasmid DNA
SH3 and multiple ankyrin repeat domains 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016148.2-6469s21c1
Sequence:CCGGCATCGACCGGGCTCTCAAATTCTCGAGAATTTGAGAGCCCGGTCGATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000137382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-1139s1c1
Sequence:CCGGGATGTGAAGAACAACAACGGACTCGAGTCCGTTGTTGTTCTTCACATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000137104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-493s1c1
Sequence:CCGGCCGAGTTTACAAACAGACCAACTCGAGTTGGTCTGTTTGTAAACTCGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000137144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-556s1c1
Sequence:CCGGGTTGAAGAAGTTCCTGGAGTACTCGAGTACTCCAGGAACTTCTTCAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000138841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-2471s1c1
Sequence:CCGGGCTCTCAACAAACTGGACGAACTCGAGTTCGTCCAGTTTGTTGAGAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000138405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-2458s1c1
Sequence:CCGGCGTGTATCAGATGGCTCTCAACTCGAGTTGAGAGCCATCTGATACACGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000138436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-492s1c1
Sequence:CCGGCCCGAGTTTACAAACAGACCACTCGAGTGGTCTGTTTGTAAACTCGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000136791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-633s1c1
Sequence:CCGGCCAATTACCATGACTCGGATTCTCGAGAATCCGAGTCATGGTAATTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000136996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-1952s1c1
Sequence:CCGGCCAAGCTTAATGGATGGGATTCTCGAGAATCCCATCCATTAAGCTTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000422984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016148.2-1902s21c1
Sequence:CCGGAGAGACTCTTCCGGCATTATACTCGAGTATAATGCCGGAAGAGTCTCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016148
SHANK1 MISSION shRNA Lentiviral Transduction Particles
SH3 and multiple ankyrin repeat domains 1
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000438068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016148.2-6469s21c1
Sequence:CCGGCATCGACCGGGCTCTCAAATTCTCGAGAATTTGAGAGCCCGGTCGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-1139s1c1
Sequence:CCGGGATGTGAAGAACAACAACGGACTCGAGTCCGTTGTTGTTCTTCACATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-493s1c1
Sequence:CCGGCCGAGTTTACAAACAGACCAACTCGAGTTGGTCTGTTTGTAAACTCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-556s1c1
Sequence:CCGGGTTGAAGAAGTTCCTGGAGTACTCGAGTACTCCAGGAACTTCTTCAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-2471s1c1
Sequence:CCGGGCTCTCAACAAACTGGACGAACTCGAGTTCGTCCAGTTTGTTGAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-2458s1c1
Sequence:CCGGCGTGTATCAGATGGCTCTCAACTCGAGTTGAGAGCCATCTGATACACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-492s1c1
Sequence:CCGGCCCGAGTTTACAAACAGACCACTCGAGTGGTCTGTTTGTAAACTCGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-633s1c1
Sequence:CCGGCCAATTACCATGACTCGGATTCTCGAGAATCCGAGTCATGGTAATTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016148.1-1952s1c1
Sequence:CCGGCCAAGCTTAATGGATGGGATTCTCGAGAATCCCATCCATTAAGCTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016148.2-1902s21c1
Sequence:CCGGAGAGACTCTTCCGGCATTATACTCGAGTATAATGCCGGAAGAGTCTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001473991
SHANK1 MISSION shRNA Bacterial Glycerol Stock
SH3 and multiple ankyrin repeat domains 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-3561s21c1
Sequence:CCGGTCCCTACCATCATCATCAAAGCTCGAGCTTTGATGATGATGGTAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-2748s1c1
Sequence:CCGGGCCTTATGCTCCGGCAGAAATCTCGAGATTTCTGCCGGAGCATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-1710s1c1
Sequence:CCGGGCAGACGTAGGAAGCTCTATTCTCGAGAATAGAGCTTCCTACGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-3045s1c1
Sequence:CCGGGCCGAGAGAAGAGCCTATATCCTCGAGGATATAGGCTCTTCTCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-6543s21c1
Sequence:CCGGACATTGACCGGGCTCTCAAATCTCGAGATTTGAGAGCCCGGTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-6391s21c1
Sequence:CCGGCAAGTTTGACGTCGCTGATTGCTCGAGCAATCAGCGACGTCAAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-6447s21c1
Sequence:CCGGAGTTCCTGGACCACGAGATTGCTCGAGCAATCTCGTGGTCCAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-4955s21c1
Sequence:CCGGGCATCCAGCCTGACCTCTTATCTCGAGATAAGAGGTCAGGCTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-2649s1c1
Sequence:CCGGACCGACCCAAAGGATTCTTTGCTCGAGCAAAGAATCCTTTGGGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-315s1c1
Sequence:CCGGCTGACTTGCATCAGACGAAATCTCGAGATTTCGTCTGATGCAAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001473991
SHANK1 MISSION shRNA shRNA Plasmid DNA
SH3 and multiple ankyrin repeat domains 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-3561s21c1
Sequence:CCGGTCCCTACCATCATCATCAAAGCTCGAGCTTTGATGATGATGGTAGGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000219572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-2748s1c1
Sequence:CCGGGCCTTATGCTCCGGCAGAAATCTCGAGATTTCTGCCGGAGCATAAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000219573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-1710s1c1
Sequence:CCGGGCAGACGTAGGAAGCTCTATTCTCGAGAATAGAGCTTCCTACGTCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000219570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-3045s1c1
Sequence:CCGGGCCGAGAGAAGAGCCTATATCCTCGAGGATATAGGCTCTTCTCTCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000242046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-6543s21c1
Sequence:CCGGACATTGACCGGGCTCTCAAATCTCGAGATTTGAGAGCCCGGTCAATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000257109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-6391s21c1
Sequence:CCGGCAAGTTTGACGTCGCTGATTGCTCGAGCAATCAGCGACGTCAAACTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000242045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-6447s21c1
Sequence:CCGGAGTTCCTGGACCACGAGATTGCTCGAGCAATCTCGTGGTCCAGGAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000242047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-4955s21c1
Sequence:CCGGGCATCCAGCCTGACCTCTTATCTCGAGATAAGAGGTCAGGCTGGATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000219574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-2649s1c1
Sequence:CCGGACCGACCCAAAGGATTCTTTGCTCGAGCAAAGAATCCTTTGGGTCGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000219571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-315s1c1
Sequence:CCGGCTGACTTGCATCAGACGAAATCTCGAGATTTCGTCTGATGCAAGTCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001473991
SHANK1 MISSION shRNA Lentiviral Transduction Particles
SH3 and multiple ankyrin repeat domains 1
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000242048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-3561s21c1
Sequence:CCGGTCCCTACCATCATCATCAAAGCTCGAGCTTTGATGATGATGGTAGGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-2748s1c1
Sequence:CCGGGCCTTATGCTCCGGCAGAAATCTCGAGATTTCTGCCGGAGCATAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-1710s1c1
Sequence:CCGGGCAGACGTAGGAAGCTCTATTCTCGAGAATAGAGCTTCCTACGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-3045s1c1
Sequence:CCGGGCCGAGAGAAGAGCCTATATCCTCGAGGATATAGGCTCTTCTCTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-6543s21c1
Sequence:CCGGACATTGACCGGGCTCTCAAATCTCGAGATTTGAGAGCCCGGTCAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-6391s21c1
Sequence:CCGGCAAGTTTGACGTCGCTGATTGCTCGAGCAATCAGCGACGTCAAACTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-6447s21c1
Sequence:CCGGAGTTCCTGGACCACGAGATTGCTCGAGCAATCTCGTGGTCCAGGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001473991.1-4955s21c1
Sequence:CCGGGCATCCAGCCTGACCTCTTATCTCGAGATAAGAGGTCAGGCTGGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-2649s1c1
Sequence:CCGGACCGACCCAAAGGATTCTTTGCTCGAGCAAAGAATCCTTTGGGTCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_001473991.1-315s1c1
Sequence:CCGGCTGACTTGCATCAGACGAAATCTCGAGATTTCGTCTGATGCAAGTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)