EMAIL THIS PAGE TO A FRIEND

SHANK3

SH3 and multiple ankyrin repeat domains 3

179 Gene Product Result for
Synonyms: DEL22q13.3 PROSAP2 PSAP2 SCZD15 SPANK-2
UniProtKB ID: Q9BYB0, Q8TET3
Gene ID:
Human(85358) Summary: This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]
Mouse(58234) SH3/ankyrin domain gene 3
Rat(59312) SH3 and multiple ankyrin repeat domains 3
Zebrafish(793484) SH3 and multiple ankyrin repeat domains protein 3
Horse(100056993) SH3 and multiple ankyrin repeat domains 3
domestic cat(101085990) SH3 and multiple ankyrin repeat domains 3
dog(474456) SH3 and multiple ankyrin repeat domains 3
chicken(101666327) SH3 and multiple ankyrin repeat domains 3
chicken(101748950) SH3 and multiple ankyrin repeat domains 3
cow(512428) SH3 and multiple ankyrin repeat domains 3
sheep(101119297) SH3 and multiple ankyrin repeat domains 3
naked mole-rat(101722405) SH3 and multiple ankyrin repeat domains 3
domestic guinea pig(100723583) SH3 and multiple ankyrin repeat domains 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003446 Anti-SHANK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
MABN790 Anti-Shank3 Antibody, clone 16E2.3 This Anti-Shank3 Antibody, clone 16E2.3 is validated for use in Western Blotting for the detection of Shank3. mouse, mouse, mouse
western blot pricing
SAB5201419 Monoclonal Anti-Shank1/Shank3 - Alkaline Phosphatase antibody produced in mouse clone S367-51, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201420 Monoclonal Anti-Shank1/Shank3 - Apc antibody produced in mouse clone S367-51, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201411 Monoclonal Anti-Shank1/Shank3 - Atto 390 antibody produced in mouse clone S367-51, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201412 Monoclonal Anti-Shank1/Shank3 - Atto 488 antibody produced in mouse clone S367-51, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201413 Monoclonal Anti-Shank1/Shank3 - Atto 565 antibody produced in mouse clone S367-51, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201414 Monoclonal Anti-Shank1/Shank3 - Atto 594 antibody produced in mouse clone S367-51, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201415 Monoclonal Anti-Shank1/Shank3 - Atto 633 antibody produced in mouse clone S367-51, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201416 Monoclonal Anti-Shank1/Shank3 - Atto 655 antibody produced in mouse clone S367-51, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201417 Monoclonal Anti-Shank1/Shank3 - Atto 680 antibody produced in mouse clone S367-51, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201418 Monoclonal Anti-Shank1/Shank3 - Atto 700 antibody produced in mouse clone S367-51, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201421 Monoclonal Anti-Shank1/Shank3 - Biotin antibody produced in mouse clone S367-51, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201422 Monoclonal Anti-Shank1/Shank3 - Fitc antibody produced in mouse clone S367-51, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201423 Monoclonal Anti-Shank1/Shank3 - Hrp antibody produced in mouse clone S367-51, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201424 Monoclonal Anti-Shank1/Shank3 - Pe/Atto 594 antibody produced in mouse clone S367-51, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201425 Monoclonal Anti-Shank1/Shank3 - Percp antibody produced in mouse clone S367-51, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201426 Monoclonal Anti-Shank1/Shank3 - Rpe antibody produced in mouse clone S367-51, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201427 Monoclonal Anti-Shank1/Shank3 - Streptavidin antibody produced in mouse clone S367-51, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201410 Monoclonal Anti-Shank1/Shank3 antibody produced in mouse clone S367-51, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200047 Monoclonal Anti-SHANK3 antibody produced in mouse clone S72-16, 1 mg/mL, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0083 AQUA Peptide VLSIGEGGFWEGTV[K] dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080420 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU074351 MISSION® esiRNA esiRNA targeting mouse Shank3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080420 Rosetta Predictions human pricing
XM_037493 Rosetta Predictions human pricing
XM_927519 Rosetta Predictions human pricing
NM_021676 Rosetta Predictions rat pricing
NM_021423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314676 predicted 1997
2 SASI_Hs02_00314677 predicted 378
3 SASI_Hs02_00314678 predicted 964
4 SASI_Hs02_00314679 predicted 916
5 SASI_Hs02_00314680 predicted 2102
6 SASI_Hs02_00314681 predicted 324
7 SASI_Hs02_00314682 predicted 270
8 SASI_Hs02_00314683 predicted 1719
9 SASI_Hs02_00314684 predicted 298
10 SASI_Hs02_00314685 predicted 1640
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_037493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278577 predicted 2230
2 SASI_Hs01_00278578 predicted 615
3 SASI_Hs01_00278579 predicted 1196
4 SASI_Hs01_00278580 predicted 1149
5 SASI_Hs01_00278581 predicted 2343
6 SASI_Hs01_00278582 predicted 503
7 SASI_Hs01_00278583 predicted 1945
8 SASI_Hs01_00278584 predicted 534
9 SASI_Hs01_00278585 predicted 1869
10 SASI_Hs01_00278586 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288473 predicted 827
2 SASI_Hs01_00288474 predicted 847
3 SASI_Hs01_00288475 predicted 614
4 SASI_Hs01_00288476 predicted 861
5 SASI_Hs01_00288477 predicted 588
6 SASI_Hs01_00288478 predicted 1628
7 SASI_Hs01_00288479 predicted 2116
8 SASI_Hs01_00288480 predicted 2133
9 SASI_Hs01_00288481 predicted 1686
10 SASI_Hs01_00288482 predicted 1669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116333 predicted 1199
2 SASI_Rn01_00116335 predicted 1898
3 SASI_Rn01_00116336 predicted 965
4 SASI_Rn01_00116337 predicted 495
5 SASI_Rn01_00116338 predicted 4699
6 SASI_Rn01_00116339 predicted 3765
7 SASI_Rn01_00116341 predicted 2125
8 SASI_Rn01_00116342 predicted 1817
9 SASI_Rn02_00262696 predicted 494
10 SASI_Rn02_00262697 predicted 1898
11 SASI_Rn01_00116334 predicted 1231
12 SASI_Rn01_00116340 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028990 predicted 250
2 SASI_Mm01_00028991 predicted 1666
3 SASI_Mm01_00028992 predicted 966
4 SASI_Mm01_00028993 predicted 4463
5 SASI_Mm01_00028994 predicted 1899
6 SASI_Mm01_00028995 predicted 1583
7 SASI_Mm01_00028996 predicted 4565
8 SASI_Mm01_00028997 predicted 1679
9 SASI_Mm01_00028998 predicted 740
10 SASI_Mm01_00028999 predicted 381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021423
SHANK3 MISSION shRNA Bacterial Glycerol Stock
SH3 and multiple ankyrin repeat domains 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021423.3-5639s21c1
Sequence:CCGGCAAATATCTCTGTCCGTAATACTCGAGTATTACGGACAGAGATATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021423.3-270s21c1
Sequence:CCGGCCGATACAAGCGGAGAGTTTACTCGAGTAAACTCTCCGCTTGTATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021423.3-1593s21c1
Sequence:CCGGGTATGACACCCGGCATGAAACCTCGAGGTTTCATGCCGGGTGTCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021423.1-4445s1c1
Sequence:CCGGCCACATACACAGTCTCACATTCTCGAGAATGTGAGACTGTGTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021423.1-821s1c1
Sequence:CCGGGCCATTATTGCAGGGAACTTTCTCGAGAAAGTTCCCTGCAATAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021423.1-850s1c1
Sequence:CCGGCGAGGTAATCAAGACCCACAACTCGAGTTGTGGGTCTTGATTACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021423.1-223s1c1
Sequence:CCGGCCAGCTACACAGCACAGATAACTCGAGTTATCTGTGCTGTGTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021423.1-851s1c1
Sequence:CCGGGAGGTAATCAAGACCCACAAACTCGAGTTTGTGGGTCTTGATTACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021423
SHANK3 MISSION shRNA shRNA Plasmid DNA
SH3 and multiple ankyrin repeat domains 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021423.3-5639s21c1
Sequence:CCGGCAAATATCTCTGTCCGTAATACTCGAGTATTACGGACAGAGATATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021423.3-270s21c1
Sequence:CCGGCCGATACAAGCGGAGAGTTTACTCGAGTAAACTCTCCGCTTGTATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021423.3-1593s21c1
Sequence:CCGGGTATGACACCCGGCATGAAACCTCGAGGTTTCATGCCGGGTGTCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021423.1-4445s1c1
Sequence:CCGGCCACATACACAGTCTCACATTCTCGAGAATGTGAGACTGTGTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021423.1-821s1c1
Sequence:CCGGGCCATTATTGCAGGGAACTTTCTCGAGAAAGTTCCCTGCAATAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021423.1-850s1c1
Sequence:CCGGCGAGGTAATCAAGACCCACAACTCGAGTTGTGGGTCTTGATTACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021423.1-223s1c1
Sequence:CCGGCCAGCTACACAGCACAGATAACTCGAGTTATCTGTGCTGTGTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021423.1-851s1c1
Sequence:CCGGGAGGTAATCAAGACCCACAAACTCGAGTTTGTGGGTCTTGATTACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021423
SHANK3 MISSION shRNA Lentiviral Transduction Particles
SH3 and multiple ankyrin repeat domains 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021423.3-5639s21c1
Sequence:CCGGCAAATATCTCTGTCCGTAATACTCGAGTATTACGGACAGAGATATTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021423.3-270s21c1
Sequence:CCGGCCGATACAAGCGGAGAGTTTACTCGAGTAAACTCTCCGCTTGTATCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021423.3-1593s21c1
Sequence:CCGGGTATGACACCCGGCATGAAACCTCGAGGTTTCATGCCGGGTGTCATACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021423.1-4445s1c1
Sequence:CCGGCCACATACACAGTCTCACATTCTCGAGAATGTGAGACTGTGTATGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021423.1-821s1c1
Sequence:CCGGGCCATTATTGCAGGGAACTTTCTCGAGAAAGTTCCCTGCAATAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021423.1-850s1c1
Sequence:CCGGCGAGGTAATCAAGACCCACAACTCGAGTTGTGGGTCTTGATTACCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021423.1-223s1c1
Sequence:CCGGCCAGCTACACAGCACAGATAACTCGAGTTATCTGTGCTGTGTAGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021423.1-851s1c1
Sequence:CCGGGAGGTAATCAAGACCCACAAACTCGAGTTTGTGGGTCTTGATTACCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080420
SHANK3 MISSION shRNA Bacterial Glycerol Stock
SH3 and multiple ankyrin repeat domains 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080420.1-270s21c1
Sequence:CCGGTCGATACAAGCGGCGAGTTTACTCGAGTAAACTCGCCGCTTGTATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080420.1-1723s21c1
Sequence:CCGGCTCACCTCACACAGCGATTATCTCGAGATAATCGCTGTGTGAGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080420.1-5696s21c1
Sequence:CCGGCAAATATCTCTGTCCGTAATACTCGAGTATTACGGACAGAGATATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080420.1-294s21c1
Sequence:CCGGCCAGAACCTCATCGATGATAACTCGAGTTATCATCGATGAGGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080420.1-2303s21c1
Sequence:CCGGCCGAGATTAGCTCATTGTTTGCTCGAGCAAACAATGAGCTAATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080420
SHANK3 MISSION shRNA shRNA Plasmid DNA
SH3 and multiple ankyrin repeat domains 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080420.1-270s21c1
Sequence:CCGGTCGATACAAGCGGCGAGTTTACTCGAGTAAACTCGCCGCTTGTATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080420.1-1723s21c1
Sequence:CCGGCTCACCTCACACAGCGATTATCTCGAGATAATCGCTGTGTGAGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080420.1-5696s21c1
Sequence:CCGGCAAATATCTCTGTCCGTAATACTCGAGTATTACGGACAGAGATATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080420.1-294s21c1
Sequence:CCGGCCAGAACCTCATCGATGATAACTCGAGTTATCATCGATGAGGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080420.1-2303s21c1
Sequence:CCGGCCGAGATTAGCTCATTGTTTGCTCGAGCAAACAATGAGCTAATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080420
SHANK3 MISSION shRNA Lentiviral Transduction Particles
SH3 and multiple ankyrin repeat domains 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080420.1-270s21c1
Sequence:CCGGTCGATACAAGCGGCGAGTTTACTCGAGTAAACTCGCCGCTTGTATCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080420.1-1723s21c1
Sequence:CCGGCTCACCTCACACAGCGATTATCTCGAGATAATCGCTGTGTGAGGTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080420.1-5696s21c1
Sequence:CCGGCAAATATCTCTGTCCGTAATACTCGAGTATTACGGACAGAGATATTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080420.1-294s21c1
Sequence:CCGGCCAGAACCTCATCGATGATAACTCGAGTTATCATCGATGAGGTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080420.1-2303s21c1
Sequence:CCGGCCGAGATTAGCTCATTGTTTGCTCGAGCAAACAATGAGCTAATCTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)