EMAIL THIS PAGE TO A FRIEND

SHB

Src homology 2 domain containing adaptor protein B

137 Gene Product Result for
Synonyms: RP11-3J10.8 bA3J10.2
UniProtKB ID: Q15464, B9EGM0, D3DRQ5, Q504U5, Q5VUM8
Gene ID:
Mouse(230126) src homology 2 domain-containing transforming protein B
Rat(362513) Src homology 2 domain containing adaptor protein B
fruit fly(252628) shortened bristles
Thale Cress(844190) SH2 domain protein B
chicken(427280) Src homology 2 domain containing adaptor protein B
dog(481619) Src homology 2 domain containing adaptor protein B
domestic cat(101090557) Src homology 2 domain containing adaptor protein B
Horse(100066128) Src homology 2 domain containing adaptor protein B
cow(538275) Src homology 2 domain containing adaptor protein B
sheep(101105557) Src homology 2 domain containing adaptor protein B
naked mole-rat(101701606) Src homology 2 domain containing adaptor protein B
Domestic Rabbit(100338867) Src homology 2 domain containing adaptor protein B
domestic guinea pig(100734161) Src homology 2 domain containing adaptor protein B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003028 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003028 Rosetta Predictions human pricing
XM_342831 Rosetta Predictions rat pricing
XR_008772 Rosetta Predictions rat pricing
XM_001474892 Rosetta Predictions mouse pricing
XM_131399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090619 predicted 1853
2 SASI_Hs01_00090621 predicted 1702
3 SASI_Hs01_00090622 predicted 1429
4 SASI_Hs01_00090624 predicted 1614
5 SASI_Hs02_00334928 predicted 1624
6 SASI_Hs01_00090626 predicted 1438
7 SASI_Hs01_00090627 predicted 1580
8 SASI_Hs02_00334929 predicted 887
9 SASI_Hs01_00090628 predicted 1903
10 SASI_Hs02_00334930 predicted 1427
11 SASI_Hs01_00090620 predicted 1990
12 SASI_Hs01_00090623 predicted 1487
13 SASI_Hs01_00090625 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342831 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142471 predicted 3417
2 SASI_Rn01_00142472 predicted 1070
3 SASI_Rn01_00142473 predicted 1289
4 SASI_Rn01_00142474 predicted 998
5 SASI_Rn01_00142475 predicted 1804
6 SASI_Rn01_00142476 predicted 2260
7 SASI_Rn01_00142477 predicted 3083
8 SASI_Rn01_00142478 predicted 1434
9 SASI_Rn01_00142479 predicted 604
10 SASI_Rn01_00142480 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166059 predicted 1523
2 SASI_Rn01_00166061 predicted 2121
3 SASI_Rn01_00166062 predicted 1298
4 SASI_Rn01_00166063 predicted 1186
5 SASI_Rn01_00166064 predicted 2207
6 SASI_Rn02_00417869 predicted 2125
7 SASI_Rn02_00417870 predicted 1212
8 SASI_Rn02_00417871 predicted 197
9 SASI_Rn01_00166065 predicted 2344
10 SASI_Rn01_00166066 predicted 1368
11 SASI_Rn01_00166060 predicted 1611
12 SASI_Rn01_00166067 predicted 506
13 SASI_Rn01_00166068 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00378587 predicted 1569
2 SASI_Mm02_00378588 predicted 2074
3 SASI_Mm02_00378589 predicted 1334
4 SASI_Mm02_00378590 predicted 1720
5 SASI_Mm02_00378591 predicted 1965
6 SASI_Mm02_00378592 predicted 1419
7 SASI_Mm02_00378593 predicted 1208
8 SASI_Mm02_00378594 predicted 1941
9 SASI_Mm02_00378595 predicted 1109
10 SASI_Mm02_00378596 predicted 2211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264293 predicted 1775
2 SASI_Mm01_00264294 predicted 2284
3 SASI_Mm01_00264295 predicted 1537
4 SASI_Mm01_00264296 predicted 1919
5 SASI_Mm01_00264297 predicted 2165
6 SASI_Mm01_00264298 predicted 1622
7 SASI_Mm01_00264299 predicted 1408
8 SASI_Mm01_00264300 predicted 2135
9 SASI_Mm01_00264301 predicted 1197
10 SASI_Mm01_00264302 predicted 1834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033306
VALIDATED
SHB MISSION shRNA Bacterial Glycerol Stock
Src homology 2 domain containing adaptor protein B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033306.1-1281s21c1
Sequence:CCGGATGACTACTCCGATCCCTTTGCTCGAGCAAAGGGATCGGAGTAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033306.1-1364s21c1
Sequence:CCGGTACGAAGCCCAGAGGATCATGCTCGAGCATGATCCTCTGGGCTTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033306.1-2216s21c1
Sequence:CCGGTAGAATGCTGTCGCCACTTACCTCGAGGTAAGTGGCGACAGCATTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033306.1-1107s21c1
Sequence:CCGGCTAAGCACCGACTCATCAAAGCTCGAGCTTTGATGAGTCGGTGCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033306.1-873s21c1
Sequence:CCGGTGCGCAAACTGCGAGCTATGTCTCGAGACATAGCTCGCAGTTTGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033306
VALIDATED
SHB MISSION shRNA shRNA Plasmid DNA
Src homology 2 domain containing adaptor protein B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033306.1-1281s21c1
Sequence:CCGGATGACTACTCCGATCCCTTTGCTCGAGCAAAGGGATCGGAGTAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033306.1-1364s21c1
Sequence:CCGGTACGAAGCCCAGAGGATCATGCTCGAGCATGATCCTCTGGGCTTCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033306.1-2216s21c1
Sequence:CCGGTAGAATGCTGTCGCCACTTACCTCGAGGTAAGTGGCGACAGCATTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033306.1-1107s21c1
Sequence:CCGGCTAAGCACCGACTCATCAAAGCTCGAGCTTTGATGAGTCGGTGCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033306.1-873s21c1
Sequence:CCGGTGCGCAAACTGCGAGCTATGTCTCGAGACATAGCTCGCAGTTTGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033306
VALIDATED
SHB MISSION shRNA Lentiviral Transduction Particles
Src homology 2 domain containing adaptor protein B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033306.1-1281s21c1
Sequence:CCGGATGACTACTCCGATCCCTTTGCTCGAGCAAAGGGATCGGAGTAGTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033306.1-1364s21c1
Sequence:CCGGTACGAAGCCCAGAGGATCATGCTCGAGCATGATCCTCTGGGCTTCGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033306.1-2216s21c1
Sequence:CCGGTAGAATGCTGTCGCCACTTACCTCGAGGTAAGTGGCGACAGCATTCTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033306.1-1107s21c1
Sequence:CCGGCTAAGCACCGACTCATCAAAGCTCGAGCTTTGATGAGTCGGTGCTTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033306.1-873s21c1
Sequence:CCGGTGCGCAAACTGCGAGCTATGTCTCGAGACATAGCTCGCAGTTTGCGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003028
VALIDATED
SHB MISSION shRNA Bacterial Glycerol Stock
Src homology 2 domain containing adaptor protein B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003028.2-1440s21c1
Sequence:CCGGATAAAGGTATCCAGTTATATGCTCGAGCATATAACTGGATACCTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003028.1-1394s1c1
Sequence:CCGGCAGAGGATCATGACAGAATTTCTCGAGAAATTCTGTCATGATCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003028.1-576s1c1
Sequence:CCGGCCAAGTGGCTAAACAAGTACTCTCGAGAGTACTTGTTTAGCCACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003028.2-1960s21c1
Sequence:CCGGGAAATACGTTCTGGGTCAGAACTCGAGTTCTGACCCAGAACGTATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003028.2-1391s21c1
Sequence:CCGGCAGAGGATCATGACAGAATTTCTCGAGAAATTCTGTCATGATCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003028.2-2332s21c1
Sequence:CCGGCTTGAGTTTCTGTGAATTAAACTCGAGTTTAATTCACAGAAACTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003028.2-573s21c1
Sequence:CCGGCCAAGTGGCTAAACAAGTACTCTCGAGAGTACTTGTTTAGCCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003028.1-1313s1c1
Sequence:CCGGGATCCCTTTGATGCCAAGAATCTCGAGATTCTTGGCATCAAAGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003028.1-1963s1c1
Sequence:CCGGGAAATACGTTCTGGGTCAGAACTCGAGTTCTGACCCAGAACGTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003028
VALIDATED
SHB MISSION shRNA shRNA Plasmid DNA
Src homology 2 domain containing adaptor protein B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003028.2-1440s21c1
Sequence:CCGGATAAAGGTATCCAGTTATATGCTCGAGCATATAACTGGATACCTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003028.1-1394s1c1
Sequence:CCGGCAGAGGATCATGACAGAATTTCTCGAGAAATTCTGTCATGATCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003028.1-576s1c1
Sequence:CCGGCCAAGTGGCTAAACAAGTACTCTCGAGAGTACTTGTTTAGCCACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003028.2-1960s21c1
Sequence:CCGGGAAATACGTTCTGGGTCAGAACTCGAGTTCTGACCCAGAACGTATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003028.2-1391s21c1
Sequence:CCGGCAGAGGATCATGACAGAATTTCTCGAGAAATTCTGTCATGATCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003028.2-2332s21c1
Sequence:CCGGCTTGAGTTTCTGTGAATTAAACTCGAGTTTAATTCACAGAAACTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003028.2-573s21c1
Sequence:CCGGCCAAGTGGCTAAACAAGTACTCTCGAGAGTACTTGTTTAGCCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003028.1-1313s1c1
Sequence:CCGGGATCCCTTTGATGCCAAGAATCTCGAGATTCTTGGCATCAAAGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003028.1-1963s1c1
Sequence:CCGGGAAATACGTTCTGGGTCAGAACTCGAGTTCTGACCCAGAACGTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003028
VALIDATED
SHB MISSION shRNA Lentiviral Transduction Particles
Src homology 2 domain containing adaptor protein B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003028.2-1440s21c1
Sequence:CCGGATAAAGGTATCCAGTTATATGCTCGAGCATATAACTGGATACCTTTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003028.1-1394s1c1
Sequence:CCGGCAGAGGATCATGACAGAATTTCTCGAGAAATTCTGTCATGATCCTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003028.1-576s1c1
Sequence:CCGGCCAAGTGGCTAAACAAGTACTCTCGAGAGTACTTGTTTAGCCACTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003028.2-1960s21c1
Sequence:CCGGGAAATACGTTCTGGGTCAGAACTCGAGTTCTGACCCAGAACGTATTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003028.2-1391s21c1
Sequence:CCGGCAGAGGATCATGACAGAATTTCTCGAGAAATTCTGTCATGATCCTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003028.2-2332s21c1
Sequence:CCGGCTTGAGTTTCTGTGAATTAAACTCGAGTTTAATTCACAGAAACTCAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003028.2-573s21c1
Sequence:CCGGCCAAGTGGCTAAACAAGTACTCTCGAGAGTACTTGTTTAGCCACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003028.1-1313s1c1
Sequence:CCGGGATCCCTTTGATGCCAAGAATCTCGAGATTCTTGGCATCAAAGGGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003028.1-1963s1c1
Sequence:CCGGGAAATACGTTCTGGGTCAGAACTCGAGTTCTGACCCAGAACGTATTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)