EMAIL THIS PAGE TO A FRIEND

SHBG

sex hormone-binding globulin

78 Gene Product Result for
Synonyms: ABP SBP TEBG
Gene ID:
Human(6462) Summary: This gene encodes a steroid binding protein that was first described as a plasma protein secreted by the liver but is now thought to participate in the regulation of steroid responses. The encoded protein binds each steroid molecule as a dimer formed from identical or nearly identical monomers. The use of alternate promoters and alternatively spliced transcripts have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Mouse(20415) sex hormone binding globulin
Rat(24775) sex hormone binding globulin
cow(404182) sex hormone-binding globulin
sheep(101102995) sex hormone-binding globulin
domestic guinea pig(100734981) sex hormone-binding globulin
Domestic Rabbit(100009224) sex hormone-binding globulin
naked mole-rat(101701053) sex hormone-binding globulin
Zebrafish(322604) sex hormone binding globulin
dog(479487) sex hormone-binding globulin
domestic cat(101099508) sex hormone-binding globulin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0734 Human SHBG / Sex Hormone-binding Globulin ELISA Kit human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0550 AQUA Peptide QVSGPLTS[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040 Rosetta Predictions human pricing
NM_012650 Rosetta Predictions rat pricing
NM_011367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031509 predicted 681
2 SASI_Hs01_00031510 predicted 587
3 SASI_Hs01_00031511 predicted 687
4 SASI_Hs01_00031512 predicted 928
5 SASI_Hs01_00031513 predicted 850
6 SASI_Hs01_00031514 predicted 307
7 SASI_Hs01_00031515 predicted 579
8 SASI_Hs01_00031516 predicted 261
9 SASI_Hs01_00031517 predicted 808
10 SASI_Hs01_00031518 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092403 predicted 453
2 SASI_Rn01_00092404 predicted 204
3 SASI_Rn01_00092405 predicted 457
4 SASI_Rn02_00259898 predicted 729
5 SASI_Rn01_00092406 predicted 831
6 SASI_Rn01_00092407 predicted 880
7 SASI_Rn01_00092408 predicted 610
8 SASI_Rn01_00092409 predicted 1143
9 SASI_Rn01_00092410 predicted 952
10 SASI_Rn01_00092411 predicted 347
11 SASI_Rn01_00092412 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044943 predicted 877
2 SASI_Mm01_00044945 predicted 1108
3 SASI_Mm01_00044946 predicted 1057
4 SASI_Mm01_00044947 predicted 456
5 SASI_Mm01_00044948 predicted 834
6 SASI_Mm01_00044949 predicted 242
7 SASI_Mm01_00044950 predicted 914
8 SASI_Mm02_00320528 predicted 980
9 SASI_Mm02_00320529 predicted 826
10 SASI_Mm01_00044951 predicted 948
11 SASI_Mm01_00044944 predicted 868
12 SASI_Mm01_00044952 predicted 968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040
SHBG MISSION shRNA Bacterial Glycerol Stock
sex hormone-binding globulin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040.3-529s21c1
Sequence:CCGGGCCATCCCATCATGAGGATTGCTCGAGCAATCCTCATGATGGGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040.3-89s21c1
Sequence:CCGGGTTGCTACTACTGCGTCACACCTCGAGGTGTGACGCAGTAGTAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040.3-684s21c1
Sequence:CCGGAGCTGTGATGTAGAATCAAATCTCGAGATTTGATTCTACATCACAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040.3-1227s21c1
Sequence:CCGGGGCACTGACGCTTCCCATTAACTCGAGTTAATGGGAAGCGTCAGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-270s1c1
Sequence:CCGGCCCTAAGGATGACTGGTTTATCTCGAGATAAACCAGTCATCCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-313s1c1
Sequence:CCGGCCTGAGATCCAACTGCACAATCTCGAGATTGTGCAGTTGGATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-700s1c1
Sequence:CCGGGAATTCAATCTCCGAGACATTCTCGAGAATGTCTCGGAGATTGAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-163s1c1
Sequence:CCGGCCTATCGCTGTCATGACCTTTCTCGAGAAAGGTCATGACAGCGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-267s1c1
Sequence:CCGGCAACCCTAAGGATGACTGGTTCTCGAGAACCAGTCATCCTTAGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040
SHBG MISSION shRNA shRNA Plasmid DNA
sex hormone-binding globulin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040.3-529s21c1
Sequence:CCGGGCCATCCCATCATGAGGATTGCTCGAGCAATCCTCATGATGGGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040.3-89s21c1
Sequence:CCGGGTTGCTACTACTGCGTCACACCTCGAGGTGTGACGCAGTAGTAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040.3-684s21c1
Sequence:CCGGAGCTGTGATGTAGAATCAAATCTCGAGATTTGATTCTACATCACAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040.3-1227s21c1
Sequence:CCGGGGCACTGACGCTTCCCATTAACTCGAGTTAATGGGAAGCGTCAGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-270s1c1
Sequence:CCGGCCCTAAGGATGACTGGTTTATCTCGAGATAAACCAGTCATCCTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-313s1c1
Sequence:CCGGCCTGAGATCCAACTGCACAATCTCGAGATTGTGCAGTTGGATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-700s1c1
Sequence:CCGGGAATTCAATCTCCGAGACATTCTCGAGAATGTCTCGGAGATTGAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-163s1c1
Sequence:CCGGCCTATCGCTGTCATGACCTTTCTCGAGAAAGGTCATGACAGCGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-267s1c1
Sequence:CCGGCAACCCTAAGGATGACTGGTTCTCGAGAACCAGTCATCCTTAGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040
SHBG MISSION shRNA Lentiviral Transduction Particles
sex hormone-binding globulin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040.3-529s21c1
Sequence:CCGGGCCATCCCATCATGAGGATTGCTCGAGCAATCCTCATGATGGGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040.3-89s21c1
Sequence:CCGGGTTGCTACTACTGCGTCACACCTCGAGGTGTGACGCAGTAGTAGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040.3-684s21c1
Sequence:CCGGAGCTGTGATGTAGAATCAAATCTCGAGATTTGATTCTACATCACAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040.3-1227s21c1
Sequence:CCGGGGCACTGACGCTTCCCATTAACTCGAGTTAATGGGAAGCGTCAGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-270s1c1
Sequence:CCGGCCCTAAGGATGACTGGTTTATCTCGAGATAAACCAGTCATCCTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-313s1c1
Sequence:CCGGCCTGAGATCCAACTGCACAATCTCGAGATTGTGCAGTTGGATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-700s1c1
Sequence:CCGGGAATTCAATCTCCGAGACATTCTCGAGAATGTCTCGGAGATTGAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-163s1c1
Sequence:CCGGCCTATCGCTGTCATGACCTTTCTCGAGAAAGGTCATGACAGCGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001040.2-267s1c1
Sequence:CCGGCAACCCTAAGGATGACTGGTTCTCGAGAACCAGTCATCCTTAGGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011367
SHBG MISSION shRNA Bacterial Glycerol Stock
sex hormone-binding globulin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-136s1c1
Sequence:CCGGCCTGCTAAGTACCTCAGCAATCTCGAGATTGCTGAGGTACTTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-540s1c1
Sequence:CCGGCCCTACTTCCAAACTTCGGTTCTCGAGAACCGAAGTTTGGAAGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-321s1c1
Sequence:CCGGGCTTGAAATCCAGCTACACAACTCGAGTTGTGTAGCTGGATTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-821s1c1
Sequence:CCGGGAACAAATTCTTCTTGGCTTACTCGAGTAAGCCAAGAAGAATTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-318s1c1
Sequence:CCGGCCAGCTTGAAATCCAGCTACACTCGAGTGTAGCTGGATTTCAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011367
SHBG MISSION shRNA shRNA Plasmid DNA
sex hormone-binding globulin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-136s1c1
Sequence:CCGGCCTGCTAAGTACCTCAGCAATCTCGAGATTGCTGAGGTACTTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-540s1c1
Sequence:CCGGCCCTACTTCCAAACTTCGGTTCTCGAGAACCGAAGTTTGGAAGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-321s1c1
Sequence:CCGGGCTTGAAATCCAGCTACACAACTCGAGTTGTGTAGCTGGATTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-821s1c1
Sequence:CCGGGAACAAATTCTTCTTGGCTTACTCGAGTAAGCCAAGAAGAATTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-318s1c1
Sequence:CCGGCCAGCTTGAAATCCAGCTACACTCGAGTGTAGCTGGATTTCAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011367
SHBG MISSION shRNA Lentiviral Transduction Particles
sex hormone-binding globulin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-136s1c1
Sequence:CCGGCCTGCTAAGTACCTCAGCAATCTCGAGATTGCTGAGGTACTTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-540s1c1
Sequence:CCGGCCCTACTTCCAAACTTCGGTTCTCGAGAACCGAAGTTTGGAAGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-321s1c1
Sequence:CCGGGCTTGAAATCCAGCTACACAACTCGAGTTGTGTAGCTGGATTTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-821s1c1
Sequence:CCGGGAACAAATTCTTCTTGGCTTACTCGAGTAAGCCAAGAAGAATTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011367.1-318s1c1
Sequence:CCGGCCAGCTTGAAATCCAGCTACACTCGAGTGTAGCTGGATTTCAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)