EMAIL THIS PAGE TO A FRIEND

SHC1

SHC (Src homology 2 domain containing) transforming protein 1

133 Gene Product Result for
Synonyms: SHC SHCA
Gene ID:
Human(6464) Summary: This gene encodes three main isoforms that differ in activities and subcellular location. While all three are adapter proteins in signal transduction pathways, the longest (p66Shc) may be involved in regulating life span and the effects of reactive oxygen species. The other two isoforms, p52Shc and p46Shc, link activated receptor tyrosine kinases to the Ras pathway by recruitment of the GRB2/SOS complex. p66Shc is not involved in Ras activation. Unlike the other two isoforms, p46Shc is targeted to the mitochondrial matrix. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Mouse(20416) src homology 2 domain-containing transforming protein C1
Rat(85385) SHC (Src homology 2 domain containing) transforming protein 1
Zebrafish(323818) SHC (Src homology 2 domain containing) transforming protein 1
dog(490439) SHC (Src homology 2 domain containing) transforming protein 1
Horse(100063053) SHC (Src homology 2 domain containing) transforming protein 1
domestic cat(101092911) SHC (Src homology 2 domain containing) transforming protein 1
chicken(395934) SHC (Src homology 2 domain containing) transforming protein 1
cow(507196) SHC (Src homology 2 domain containing) transforming protein 1
sheep(101113548) SHC (Src homology 2 domain containing) transforming protein 1
naked mole-rat(101717434) SHC (Src homology 2 domain containing) transforming protein 1
domestic guinea pig(100734561) SHC (Src homology 2 domain containing) transforming protein 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003029 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011368 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011368 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011368 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003029 siRNAs that have been validated in the lab human pricing
NM_183001 Rosetta Predictions human pricing
NM_053517 Rosetta Predictions rat pricing
NM_001113331 Rosetta Predictions mouse pricing
NM_011368 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003029 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020611 validated 597
1 SASI_Hs01_00020612 validated 355
1 SASI_Hs01_00020613 validated 556
2 SASI_Hs01_00020614 predicted 514
3 SASI_Hs01_00020615 predicted 459
4 SASI_Hs01_00020617 predicted 549
5 SASI_Hs01_00020618 predicted 331
6 SASI_Hs01_00020619 predicted 527
7 SASI_Hs01_00020620 predicted 552
8 SASI_Hs02_00334931 predicted 617
9 SASI_Hs01_00020616 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019572 predicted 808
2 SASI_Hs01_00019573 predicted 562
3 SASI_Hs01_00019574 predicted 763
4 SASI_Hs01_00019575 predicted 721
5 SASI_Hs01_00019576 predicted 673
6 SASI_Hs01_00019578 predicted 765
7 SASI_Hs01_00019579 predicted 542
8 SASI_Hs01_00019580 predicted 734
9 SASI_Hs01_00019581 predicted 756
10 SASI_Hs02_00371158 predicted 824
11 SASI_Hs01_00019577 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043695 predicted 478
2 SASI_Rn01_00043696 predicted 337
3 SASI_Rn01_00043697 predicted 1608
4 SASI_Rn01_00043699 predicted 453
5 SASI_Rn01_00043700 predicted 1581
6 SASI_Rn01_00043702 predicted 544
7 SASI_Rn01_00043703 predicted 935
8 SASI_Rn02_00266126 predicted 1437
9 SASI_Rn02_00266127 predicted 1277
10 SASI_Rn02_00266128 predicted 1402
11 SASI_Rn01_00043694 predicted 1514
12 SASI_Rn01_00043698 predicted 1041
13 SASI_Rn01_00043701 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307383 predicted 923
2 SASI_Mm02_00307384 predicted 1720
3 SASI_Mm02_00307385 predicted 1990
4 SASI_Mm02_00307386 predicted 891
5 SASI_Mm02_00307387 predicted 1852
6 SASI_Mm02_00307388 predicted 1030
7 SASI_Mm02_00307389 predicted 989
8 SASI_Mm02_00307390 predicted 243
9 SASI_Mm02_00307391 predicted 1957
10 SASI_Mm02_00307392 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320530 predicted 484
2 SASI_Mm02_00320531 predicted 1282
3 SASI_Mm02_00320532 predicted 1549
4 SASI_Mm02_00320533 predicted 455
5 SASI_Mm02_00320534 predicted 1403
6 SASI_Mm02_00320535 predicted 585
7 SASI_Mm02_00320536 predicted 549
8 SASI_Mm02_00320537 predicted 1508
9 SASI_Mm02_00320538 predicted 709
10 SASI_Mm02_00320539 predicted 363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003029
VALIDATED
SHC1 MISSION shRNA Bacterial Glycerol Stock
SHC (Src homology 2 domain containing) transforming protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003029.4-2425s21c1
Sequence:CCGGGCCTATGTACTCTACGCCAAACTCGAGTTTGGCGTAGAGTACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003029.4-1579s21c1
Sequence:CCGGTCAGCTACCACATGGACAATCCTCGAGGATTGTCCATGTGGTAGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003029.4-1553s21c1
Sequence:CCGGCCGCTTTGAAAGTGTCAGTCACTCGAGTGACTGACACTTTCAAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003029.4-2101s21c1
Sequence:CCGGTGACCATCTCTTAGGTCTAATCTCGAGATTAGACCTAAGAGATGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A-431
TRC Version: 1 Clone ID:NM_003029.x-677s1c1
Sequence:CCGGCTACTTGGTTCGGTACATGGGCTCGAGCCCATGTACCGAACCAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.x-2563s1c1
Sequence:CCGGTATGCAACCCTTAGAGATTGCCTCGAGGCAATCTCTAAGGGTTGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.3-823s1c1
Sequence:CCGGCCTGACCATCAGTACTATAATCTCGAGATTATAGTACTGATGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003029.3-198s1c1
Sequence:CCGGCCACGGGAGCTTTGTCAATAACTCGAGTTATTGACAAAGCTCCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.3-2306s1c1
Sequence:CCGGGCCTATGTACTCTACGCCAAACTCGAGTTTGGCGTAGAGTACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003029.3-555s1c1
Sequence:CCGGCCACATGCAATCTATCTCATTCTCGAGAATGAGATAGATTGCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.3-1434s1c1
Sequence:CCGGCCGCTTTGAAAGTGTCAGTCACTCGAGTGACTGACACTTTCAAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.x-236s1c1
Sequence:CCGGAATGAGTCTCTGTCATCGCTCTCGAGAGCGATGACAGAGACTCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003029
VALIDATED
SHC1 MISSION shRNA shRNA Plasmid DNA
SHC (Src homology 2 domain containing) transforming protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003029.4-2425s21c1
Sequence:CCGGGCCTATGTACTCTACGCCAAACTCGAGTTTGGCGTAGAGTACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003029.4-1579s21c1
Sequence:CCGGTCAGCTACCACATGGACAATCCTCGAGGATTGTCCATGTGGTAGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003029.4-1553s21c1
Sequence:CCGGCCGCTTTGAAAGTGTCAGTCACTCGAGTGACTGACACTTTCAAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003029.4-2101s21c1
Sequence:CCGGTGACCATCTCTTAGGTCTAATCTCGAGATTAGACCTAAGAGATGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A-431
TRC Version: 1 Clone ID:NM_003029.x-677s1c1
Sequence:CCGGCTACTTGGTTCGGTACATGGGCTCGAGCCCATGTACCGAACCAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.x-2563s1c1
Sequence:CCGGTATGCAACCCTTAGAGATTGCCTCGAGGCAATCTCTAAGGGTTGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.3-823s1c1
Sequence:CCGGCCTGACCATCAGTACTATAATCTCGAGATTATAGTACTGATGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003029.3-198s1c1
Sequence:CCGGCCACGGGAGCTTTGTCAATAACTCGAGTTATTGACAAAGCTCCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.3-2306s1c1
Sequence:CCGGGCCTATGTACTCTACGCCAAACTCGAGTTTGGCGTAGAGTACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003029.3-555s1c1
Sequence:CCGGCCACATGCAATCTATCTCATTCTCGAGAATGAGATAGATTGCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.3-1434s1c1
Sequence:CCGGCCGCTTTGAAAGTGTCAGTCACTCGAGTGACTGACACTTTCAAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.x-236s1c1
Sequence:CCGGAATGAGTCTCTGTCATCGCTCTCGAGAGCGATGACAGAGACTCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003029
VALIDATED
SHC1 MISSION shRNA Lentiviral Transduction Particles
SHC (Src homology 2 domain containing) transforming protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003029.4-2425s21c1
Sequence:CCGGGCCTATGTACTCTACGCCAAACTCGAGTTTGGCGTAGAGTACATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003029.4-1579s21c1
Sequence:CCGGTCAGCTACCACATGGACAATCCTCGAGGATTGTCCATGTGGTAGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003029.4-1553s21c1
Sequence:CCGGCCGCTTTGAAAGTGTCAGTCACTCGAGTGACTGACACTTTCAAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003029.4-2101s21c1
Sequence:CCGGTGACCATCTCTTAGGTCTAATCTCGAGATTAGACCTAAGAGATGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A-431
TRC Version: 1 Clone ID:NM_003029.x-677s1c1
Sequence:CCGGCTACTTGGTTCGGTACATGGGCTCGAGCCCATGTACCGAACCAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.x-2563s1c1
Sequence:CCGGTATGCAACCCTTAGAGATTGCCTCGAGGCAATCTCTAAGGGTTGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.3-823s1c1
Sequence:CCGGCCTGACCATCAGTACTATAATCTCGAGATTATAGTACTGATGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003029.3-198s1c1
Sequence:CCGGCCACGGGAGCTTTGTCAATAACTCGAGTTATTGACAAAGCTCCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.3-2306s1c1
Sequence:CCGGGCCTATGTACTCTACGCCAAACTCGAGTTTGGCGTAGAGTACATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003029.3-555s1c1
Sequence:CCGGCCACATGCAATCTATCTCATTCTCGAGAATGAGATAGATTGCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.3-1434s1c1
Sequence:CCGGCCGCTTTGAAAGTGTCAGTCACTCGAGTGACTGACACTTTCAAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003029.x-236s1c1
Sequence:CCGGAATGAGTCTCTGTCATCGCTCTCGAGAGCGATGACAGAGACTCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011368
VALIDATED
SHC1 MISSION shRNA Bacterial Glycerol Stock
SHC (Src homology 2 domain containing) transforming protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-518s21c1
Sequence:CCGGGCCGACTGCAAACAGATCATTCTCGAGAATGATCTGTTTGCAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-815s21c1
Sequence:CCGGCCTGACCATCAGTACTACAATCTCGAGATTGTAGTACTGATGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-1397s21c1
Sequence:CCGGCGGACAAAGGATCACCGCTTTCTCGAGAAAGCGGTGATCCTTTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-353s21c1
Sequence:CCGGGCCATCAGTTTGGTGTGTGAACTCGAGTTCACACACCAAACTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-816s1c1
Sequence:CCGGCCTGACCATCAGTACTACAATCTCGAGATTGTAGTACTGATGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-593s21c1
Sequence:CCGGGCTGAGTATGTTGCCTATGTTCTCGAGAACATAGGCAACATACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-1398s1c1
Sequence:CCGGCGGACAAAGGATCACCGCTTTCTCGAGAAAGCGGTGATCCTTTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-594s1c1
Sequence:CCGGGCTGAGTATGTTGCCTATGTTCTCGAGAACATAGGCAACATACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-519s1c1
Sequence:CCGGGCCGACTGCAAACAGATCATTCTCGAGAATGATCTGTTTGCAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-354s1c1
Sequence:CCGGGCCATCAGTTTGGTGTGTGAACTCGAGTTCACACACCAAACTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011368
VALIDATED
SHC1 MISSION shRNA shRNA Plasmid DNA
SHC (Src homology 2 domain containing) transforming protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-518s21c1
Sequence:CCGGGCCGACTGCAAACAGATCATTCTCGAGAATGATCTGTTTGCAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-815s21c1
Sequence:CCGGCCTGACCATCAGTACTACAATCTCGAGATTGTAGTACTGATGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-1397s21c1
Sequence:CCGGCGGACAAAGGATCACCGCTTTCTCGAGAAAGCGGTGATCCTTTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-353s21c1
Sequence:CCGGGCCATCAGTTTGGTGTGTGAACTCGAGTTCACACACCAAACTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-816s1c1
Sequence:CCGGCCTGACCATCAGTACTACAATCTCGAGATTGTAGTACTGATGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-593s21c1
Sequence:CCGGGCTGAGTATGTTGCCTATGTTCTCGAGAACATAGGCAACATACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-1398s1c1
Sequence:CCGGCGGACAAAGGATCACCGCTTTCTCGAGAAAGCGGTGATCCTTTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-594s1c1
Sequence:CCGGGCTGAGTATGTTGCCTATGTTCTCGAGAACATAGGCAACATACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-519s1c1
Sequence:CCGGGCCGACTGCAAACAGATCATTCTCGAGAATGATCTGTTTGCAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-354s1c1
Sequence:CCGGGCCATCAGTTTGGTGTGTGAACTCGAGTTCACACACCAAACTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011368
VALIDATED
SHC1 MISSION shRNA Lentiviral Transduction Particles
SHC (Src homology 2 domain containing) transforming protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-518s21c1
Sequence:CCGGGCCGACTGCAAACAGATCATTCTCGAGAATGATCTGTTTGCAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-815s21c1
Sequence:CCGGCCTGACCATCAGTACTACAATCTCGAGATTGTAGTACTGATGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-1397s21c1
Sequence:CCGGCGGACAAAGGATCACCGCTTTCTCGAGAAAGCGGTGATCCTTTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-353s21c1
Sequence:CCGGGCCATCAGTTTGGTGTGTGAACTCGAGTTCACACACCAAACTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-816s1c1
Sequence:CCGGCCTGACCATCAGTACTACAATCTCGAGATTGTAGTACTGATGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011368.4-593s21c1
Sequence:CCGGGCTGAGTATGTTGCCTATGTTCTCGAGAACATAGGCAACATACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-1398s1c1
Sequence:CCGGCGGACAAAGGATCACCGCTTTCTCGAGAAAGCGGTGATCCTTTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-594s1c1
Sequence:CCGGGCTGAGTATGTTGCCTATGTTCTCGAGAACATAGGCAACATACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-519s1c1
Sequence:CCGGGCCGACTGCAAACAGATCATTCTCGAGAATGATCTGTTTGCAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011368.3-354s1c1
Sequence:CCGGGCCATCAGTTTGGTGTGTGAACTCGAGTTCACACACCAAACTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)