EMAIL THIS PAGE TO A FRIEND

SHFM1

split hand/foot malformation (ectrodactyly) type 1

52 Gene Product Result for
Synonyms: DSS1 ECD SEM1 SHFD1 SHSF1 Shfdg1
UniProtKB ID: P60896, Q13437, Q61067
Gene ID:
Human(7979) Summary: The product of this gene has been localized within the split hand/split foot malformation locus SHFM1 at chromosome 7. It has been proposed to be a candidate gene for the autosomal dominant form of the heterogeneous limb developmental disorder split hand/split foot malformation type 1. In addition, it has been shown to directly interact with BRCA2. It also may play a role in the completion of the cell cycle. [provided by RefSeq, Jul 2008]
Mouse(20422) split hand/foot malformation (ectrodactyly) type 1
Rat(680532) split hand/foot malformation (ectrodactyly) type 1
Zebrafish(322269) split hand/foot malformation (ectrodactyly) type 1
chicken(772237) split hand/foot malformation (ectrodactyly) type 1
dog(608719) split hand/foot malformation (ectrodactyly) type 1
domestic cat(101094744) split hand/foot malformation (ectrodactyly) type 1
cow(767981) split hand/foot malformation (ectrodactyly) type 1
sheep(101119038) split hand/foot malformation (ectrodactyly) type 1
domestic guinea pig(100735574) split hand/foot malformation (ectrodactyly) type 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009169 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009169 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009169 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006304 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006304 Rosetta Predictions human pricing
NM_001126090 Rosetta Predictions rat pricing
NM_009169 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017254 predicted 274
2 SASI_Hs01_00017255 predicted 234
3 SASI_Hs01_00017256 predicted 269
4 SASI_Hs02_00341321 predicted 223
5 SASI_Hs01_00017257 predicted 271
6 SASI_Hs01_00017258 predicted 230
7 SASI_Hs01_00017259 predicted 201
8 SASI_Hs01_00017260 predicted 237
9 SASI_Hs01_00017262 predicted 265
10 SASI_Hs01_00017263 predicted 272
11 SASI_Hs01_00017261 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252913 predicted 204
2 SASI_Rn02_00252914 predicted 341
3 SASI_Rn02_00252915 predicted 231
4 SASI_Rn02_00252916 predicted 337
5 SASI_Rn02_00252917 predicted 276
6 SASI_Rn02_00252918 predicted 309
7 SASI_Rn02_00252919 predicted 505
8 SASI_Rn02_00252920 predicted 424
9 SASI_Rn02_00252921 predicted 251
10 SASI_Rn02_00252922 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174008 predicted 208
2 SASI_Mm02_00315524 predicted 207
3 SASI_Mm02_00315525 predicted 212
4 SASI_Mm01_00174013 predicted 221
5 SASI_Mm02_00315526 predicted 217
6 SASI_Mm02_00315527 predicted 209
7 SASI_Mm02_00315528 predicted 204
8 SASI_Mm02_00315529 predicted 220
9 SASI_Mm02_00315530 predicted 207
10 SASI_Mm02_00315531 predicted 183
11 SASI_Mm01_00174009 predicted 136
12 SASI_Mm01_00174010 predicted 110
13 SASI_Mm01_00174011 predicted 173
14 SASI_Mm01_00174012 predicted 213
15 SASI_Mm01_00174014 predicted 258
16 SASI_Mm01_00174015 predicted 274
17 SASI_Mm01_00174016 predicted 122
18 SASI_Mm01_00174017 predicted 321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009169
VALIDATED
SHFM1 MISSION shRNA Bacterial Glycerol Stock
split hand/foot malformation (ectrodactyly) type 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009169.2-225s21c1
Sequence:CCGGGATAATTGGGATGATGACAATCTCGAGATTGTCATCATCCCAATTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009169.2-151s21c1
Sequence:CCGGACGACGAGTTCGAGGAGTTTCCTCGAGGAAACTCCTCGAACTCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009169.1-237s1c1
Sequence:CCGGGCTACAAGATGGAGACATCATCTCGAGATGATGTCTCCATCTTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009169.1-128s1c1
Sequence:CCGGGCTGGCTTAGATGAAGATGAACTCGAGTTCATCTTCATCTAAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009169.2-186s21c1
Sequence:CCGGGCTGGCTTAGATGAAGATGAACTCGAGTTCATCTTCATCTAAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009169.2-211s21c1
Sequence:CCGGCACATGTCTGGGAGGATAATTCTCGAGAATTATCCTCCCAGACATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009169.1-202s1c1
Sequence:CCGGCTCTAACCAGTTACGTGCTGACTCGAGTCAGCACGTAACTGGTTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009169.1-167s1c1
Sequence:CCGGGATAATTGGGATGATGACAATCTCGAGATTGTCATCATCCCAATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009169.1-137s1c1
Sequence:CCGGGATGAAGATGAAGATGCACATCTCGAGATGTGCATCTTCATCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009169.1-176s1c1
Sequence:CCGGGATGATGACAATGTAGAAGATCTCGAGATCTTCTACATTGTCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009169
VALIDATED
SHFM1 MISSION shRNA shRNA Plasmid DNA
split hand/foot malformation (ectrodactyly) type 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009169.2-225s21c1
Sequence:CCGGGATAATTGGGATGATGACAATCTCGAGATTGTCATCATCCCAATTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009169.2-151s21c1
Sequence:CCGGACGACGAGTTCGAGGAGTTTCCTCGAGGAAACTCCTCGAACTCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009169.1-237s1c1
Sequence:CCGGGCTACAAGATGGAGACATCATCTCGAGATGATGTCTCCATCTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009169.1-128s1c1
Sequence:CCGGGCTGGCTTAGATGAAGATGAACTCGAGTTCATCTTCATCTAAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009169.2-186s21c1
Sequence:CCGGGCTGGCTTAGATGAAGATGAACTCGAGTTCATCTTCATCTAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009169.2-211s21c1
Sequence:CCGGCACATGTCTGGGAGGATAATTCTCGAGAATTATCCTCCCAGACATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009169.1-202s1c1
Sequence:CCGGCTCTAACCAGTTACGTGCTGACTCGAGTCAGCACGTAACTGGTTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009169.1-167s1c1
Sequence:CCGGGATAATTGGGATGATGACAATCTCGAGATTGTCATCATCCCAATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009169.1-137s1c1
Sequence:CCGGGATGAAGATGAAGATGCACATCTCGAGATGTGCATCTTCATCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009169.1-176s1c1
Sequence:CCGGGATGATGACAATGTAGAAGATCTCGAGATCTTCTACATTGTCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009169
VALIDATED
SHFM1 MISSION shRNA Lentiviral Transduction Particles
split hand/foot malformation (ectrodactyly) type 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009169.2-225s21c1
Sequence:CCGGGATAATTGGGATGATGACAATCTCGAGATTGTCATCATCCCAATTATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009169.2-151s21c1
Sequence:CCGGACGACGAGTTCGAGGAGTTTCCTCGAGGAAACTCCTCGAACTCGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009169.1-237s1c1
Sequence:CCGGGCTACAAGATGGAGACATCATCTCGAGATGATGTCTCCATCTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009169.1-128s1c1
Sequence:CCGGGCTGGCTTAGATGAAGATGAACTCGAGTTCATCTTCATCTAAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009169.2-186s21c1
Sequence:CCGGGCTGGCTTAGATGAAGATGAACTCGAGTTCATCTTCATCTAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009169.2-211s21c1
Sequence:CCGGCACATGTCTGGGAGGATAATTCTCGAGAATTATCCTCCCAGACATGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009169.1-202s1c1
Sequence:CCGGCTCTAACCAGTTACGTGCTGACTCGAGTCAGCACGTAACTGGTTAGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009169.1-167s1c1
Sequence:CCGGGATAATTGGGATGATGACAATCTCGAGATTGTCATCATCCCAATTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009169.1-137s1c1
Sequence:CCGGGATGAAGATGAAGATGCACATCTCGAGATGTGCATCTTCATCTTCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009169.1-176s1c1
Sequence:CCGGGATGATGACAATGTAGAAGATCTCGAGATCTTCTACATTGTCATCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006304
VALIDATED
SHFM1 MISSION shRNA Bacterial Glycerol Stock
split hand/foot malformation (ectrodactyly) type 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006304.1-270s21c1
Sequence:CCGGGTAGAGGATGACTTCTCTAATCTCGAGATTAGAGAAGTCATCCTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006304.1-345s1c1
Sequence:CCGGCCAGAAGAAGTGTTGAAGTAACTCGAGTTACTTCAACACTTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006304.1-300s1c1
Sequence:CCGGGCTGAACTAGAGAAACATGGTCTCGAGACCATGTTTCTCTAGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006304.1-303s1c1
Sequence:CCGGGAACTAGAGAAACATGGTTATCTCGAGATAACCATGTTTCTCTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006304.1-270s1c1
Sequence:CCGGGTAGAGGATGACTTCTCTAATCTCGAGATTAGAGAAGTCATCCTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006304.1-210s1c1
Sequence:CCGGGCTGGCTTAGATGAAGATGAACTCGAGTTCATCTTCATCTAAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006304.1-345s21c1
Sequence:CCGGCCAGAAGAAGTGTTGAAGTAACTCGAGTTACTTCAACACTTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006304.1-210s21c1
Sequence:CCGGGCTGGCTTAGATGAAGATGAACTCGAGTTCATCTTCATCTAAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006304.1-300s21c1
Sequence:CCGGGCTGAACTAGAGAAACATGGTCTCGAGACCATGTTTCTCTAGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006304
VALIDATED
SHFM1 MISSION shRNA shRNA Plasmid DNA
split hand/foot malformation (ectrodactyly) type 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006304.1-270s21c1
Sequence:CCGGGTAGAGGATGACTTCTCTAATCTCGAGATTAGAGAAGTCATCCTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006304.1-345s1c1
Sequence:CCGGCCAGAAGAAGTGTTGAAGTAACTCGAGTTACTTCAACACTTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006304.1-300s1c1
Sequence:CCGGGCTGAACTAGAGAAACATGGTCTCGAGACCATGTTTCTCTAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006304.1-303s1c1
Sequence:CCGGGAACTAGAGAAACATGGTTATCTCGAGATAACCATGTTTCTCTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006304.1-270s1c1
Sequence:CCGGGTAGAGGATGACTTCTCTAATCTCGAGATTAGAGAAGTCATCCTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006304.1-210s1c1
Sequence:CCGGGCTGGCTTAGATGAAGATGAACTCGAGTTCATCTTCATCTAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006304.1-345s21c1
Sequence:CCGGCCAGAAGAAGTGTTGAAGTAACTCGAGTTACTTCAACACTTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006304.1-210s21c1
Sequence:CCGGGCTGGCTTAGATGAAGATGAACTCGAGTTCATCTTCATCTAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006304.1-300s21c1
Sequence:CCGGGCTGAACTAGAGAAACATGGTCTCGAGACCATGTTTCTCTAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006304
VALIDATED
SHFM1 MISSION shRNA Lentiviral Transduction Particles
split hand/foot malformation (ectrodactyly) type 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006304.1-270s21c1
Sequence:CCGGGTAGAGGATGACTTCTCTAATCTCGAGATTAGAGAAGTCATCCTCTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006304.1-345s1c1
Sequence:CCGGCCAGAAGAAGTGTTGAAGTAACTCGAGTTACTTCAACACTTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006304.1-300s1c1
Sequence:CCGGGCTGAACTAGAGAAACATGGTCTCGAGACCATGTTTCTCTAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006304.1-303s1c1
Sequence:CCGGGAACTAGAGAAACATGGTTATCTCGAGATAACCATGTTTCTCTAGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006304.1-270s1c1
Sequence:CCGGGTAGAGGATGACTTCTCTAATCTCGAGATTAGAGAAGTCATCCTCTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006304.1-210s1c1
Sequence:CCGGGCTGGCTTAGATGAAGATGAACTCGAGTTCATCTTCATCTAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006304.1-345s21c1
Sequence:CCGGCCAGAAGAAGTGTTGAAGTAACTCGAGTTACTTCAACACTTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006304.1-210s21c1
Sequence:CCGGGCTGGCTTAGATGAAGATGAACTCGAGTTCATCTTCATCTAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006304.1-300s21c1
Sequence:CCGGGCTGAACTAGAGAAACATGGTCTCGAGACCATGTTTCTCTAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)