EMAIL THIS PAGE TO A FRIEND

SHMT2

serine hydroxymethyltransferase 2 (mitochondrial)

64 Gene Product Result for
Synonyms: GLYA SHMT
UniProtKB ID: P34897, B7Z9F1, E7EQ19, E7EU43, O00740, Q8N1A5
Gene ID:
Human(6472) Summary: This gene encodes the mitochondrial form of a pyridoxal phosphate-dependent enzyme that catalyzes the reversible reaction of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. The encoded product is primarily responsible for glycine synthesis. The activity of the encoded protein has been suggested to be the primary source of intracellular glycine. The gene which encodes the cytosolic form of this enzyme is located on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(108037) serine hydroxymethyltransferase 2 (mitochondrial)
Rat(299857) serine hydroxymethyltransferase 2 (mitochondrial)
Zebrafish(100144628) serine hydroxymethyltransferase 2 (mitochondrial)
Horse(100050119) serine hydroxymethyltransferase 2 (mitochondrial)
domestic cat(101091290) serine hydroxymethyltransferase 2 (mitochondrial)
dog(607458) serine hydroxymethyltransferase 2 (mitochondrial)
Domestic Rabbit(100009293) serine hydroxymethyltransferase 2 (mitochondrial)
naked mole-rat(101721429) serine hydroxymethyltransferase 2 (mitochondrial)
domestic guinea pig(100725949) serine hydroxymethyltransferase 2 (mitochondrial)
cow(507197) serine hydroxymethyltransferase 2 (mitochondrial)
sheep(101101880) serine hydroxymethyltransferase 2 (mitochondrial)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
MABS1822 Anti-SHMT Antibody, clone 4D2.1 Anti-SHMT, clone 4D2.1, Cat. No. MABS1822, is a mouse monoclonal antibody that detects mitochondrial Serine hydroxymethyltransferase and has been tested for use in Immunohistochemistry (Paraffin) and Western Blotting. human, human
immunohistochemistry, western blot pricing
SAB1100388 Anti-SHMT2 (36-49) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100389 Anti-SHMT2 (431-445) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV46129 Anti-SHMT2 (AB1) antibody produced in rabbit affinity isolated antibody human, guinea pig, dog, mouse, rat, horse, rabbit
immunohistochemistry, western blot pricing
AV46128 Anti-SHMT2 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, rat, horse, guinea pig, mouse, rabbit, human, dog
immunohistochemistry, western blot pricing
SAB1406436 Anti-SHMT2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA020549 Anti-SHMT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 Antibody Enhanced Validation mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA020543 Anti-SHMT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 Antibody Enhanced Validation mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028230 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028230 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028230 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005412 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005412 Rosetta Predictions human pricing
NM_001008322 Rosetta Predictions rat pricing
NM_028230 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094721 predicted 693
2 SASI_Hs01_00094722 predicted 932
3 SASI_Hs01_00094723 predicted 1294
4 SASI_Hs01_00094724 predicted 304
5 SASI_Hs01_00094725 predicted 553
6 SASI_Hs01_00094726 predicted 795
7 SASI_Hs01_00094727 predicted 1334
8 SASI_Hs01_00094728 predicted 300
9 SASI_Hs01_00094729 predicted 1337
10 SASI_Hs01_00094730 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082287 predicted 1104
2 SASI_Rn01_00082288 predicted 1303
3 SASI_Rn02_00199060 predicted 356
4 SASI_Rn01_00082289 predicted 462
5 SASI_Rn01_00082290 predicted 1347
6 SASI_Rn01_00082291 predicted 1393
7 SASI_Rn01_00082292 predicted 1405
8 SASI_Rn01_00082293 predicted 1306
9 SASI_Rn02_00199061 predicted 1348
10 SASI_Rn01_00082294 predicted 381
11 SASI_Rn01_00082295 predicted 859
12 SASI_Rn01_00082296 predicted 1339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053143 predicted 801
2 SASI_Mm02_00333554 predicted 1039
3 SASI_Mm02_00333555 predicted 831
4 SASI_Mm02_00333556 predicted 972
5 SASI_Mm01_00053148 predicted 1789
6 SASI_Mm02_00333557 predicted 1462
7 SASI_Mm01_00053149 predicted 703
8 SASI_Mm02_00333558 predicted 1051
9 SASI_Mm02_00333559 predicted 618
10 SASI_Mm01_00053151 predicted 515
11 SASI_Mm01_00053142 predicted 1783
12 SASI_Mm01_00053144 predicted 1851
13 SASI_Mm01_00053145 predicted 1808
14 SASI_Mm01_00053146 predicted 1848
15 SASI_Mm01_00053147 predicted 926
16 SASI_Mm01_00053150 predicted 1755
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028230
SHMT2 MISSION shRNA Bacterial Glycerol Stock
serine hydroxymethyltransferase 2 (mitochondrial)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028230.3-1022s21c1
Sequence:CCGGACTGGCAAAGAGATCCCTTATCTCGAGATAAGGGATCTCTTTGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028230.3-1793s21c1
Sequence:CCGGCCAGAATTTGTAGCTGAGATTCTCGAGAATCTCAGCTACAAATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028230.2-1793s1c1
Sequence:CCGGCCAGAATTTGTAGCTGAGATTCTCGAGAATCTCAGCTACAAATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028230.2-914s1c1
Sequence:CCGGCCTTTCAAGTACGCGGATGTTCTCGAGAACATCCGCGTACTTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028230.2-805s1c1
Sequence:CCGGCCTCATTGACTATGCACGCATCTCGAGATGCGTGCATAGTCAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028230.2-1022s1c1
Sequence:CCGGACTGGCAAAGAGATCCCTTATCTCGAGATAAGGGATCTCTTTGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028230.2-1054s1c1
Sequence:CCGGCCGAATCAACTTCGCTGTGTTCTCGAGAACACAGCGAAGTTGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028230.3-1054s21c1
Sequence:CCGGCCGAATCAACTTCGCTGTGTTCTCGAGAACACAGCGAAGTTGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028230.3-805s21c1
Sequence:CCGGCCTCATTGACTATGCACGCATCTCGAGATGCGTGCATAGTCAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028230
SHMT2 MISSION shRNA shRNA Plasmid DNA
serine hydroxymethyltransferase 2 (mitochondrial)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028230.3-1022s21c1
Sequence:CCGGACTGGCAAAGAGATCCCTTATCTCGAGATAAGGGATCTCTTTGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028230.3-1793s21c1
Sequence:CCGGCCAGAATTTGTAGCTGAGATTCTCGAGAATCTCAGCTACAAATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028230.2-1793s1c1
Sequence:CCGGCCAGAATTTGTAGCTGAGATTCTCGAGAATCTCAGCTACAAATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028230.2-914s1c1
Sequence:CCGGCCTTTCAAGTACGCGGATGTTCTCGAGAACATCCGCGTACTTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028230.2-805s1c1
Sequence:CCGGCCTCATTGACTATGCACGCATCTCGAGATGCGTGCATAGTCAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028230.2-1022s1c1
Sequence:CCGGACTGGCAAAGAGATCCCTTATCTCGAGATAAGGGATCTCTTTGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028230.2-1054s1c1
Sequence:CCGGCCGAATCAACTTCGCTGTGTTCTCGAGAACACAGCGAAGTTGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028230.3-1054s21c1
Sequence:CCGGCCGAATCAACTTCGCTGTGTTCTCGAGAACACAGCGAAGTTGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028230.3-805s21c1
Sequence:CCGGCCTCATTGACTATGCACGCATCTCGAGATGCGTGCATAGTCAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028230
SHMT2 MISSION shRNA Lentiviral Transduction Particles
serine hydroxymethyltransferase 2 (mitochondrial)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028230.3-1022s21c1
Sequence:CCGGACTGGCAAAGAGATCCCTTATCTCGAGATAAGGGATCTCTTTGCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028230.3-1793s21c1
Sequence:CCGGCCAGAATTTGTAGCTGAGATTCTCGAGAATCTCAGCTACAAATTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028230.2-1793s1c1
Sequence:CCGGCCAGAATTTGTAGCTGAGATTCTCGAGAATCTCAGCTACAAATTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028230.2-914s1c1
Sequence:CCGGCCTTTCAAGTACGCGGATGTTCTCGAGAACATCCGCGTACTTGAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028230.2-805s1c1
Sequence:CCGGCCTCATTGACTATGCACGCATCTCGAGATGCGTGCATAGTCAATGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028230.2-1022s1c1
Sequence:CCGGACTGGCAAAGAGATCCCTTATCTCGAGATAAGGGATCTCTTTGCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028230.2-1054s1c1
Sequence:CCGGCCGAATCAACTTCGCTGTGTTCTCGAGAACACAGCGAAGTTGATTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028230.3-1054s21c1
Sequence:CCGGCCGAATCAACTTCGCTGTGTTCTCGAGAACACAGCGAAGTTGATTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028230.3-805s21c1
Sequence:CCGGCCTCATTGACTATGCACGCATCTCGAGATGCGTGCATAGTCAATGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005412
VALIDATED
SHMT2 MISSION shRNA Bacterial Glycerol Stock
serine hydroxymethyltransferase 2 (mitochondrial)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005412.4-1639s21c1
Sequence:CCGGTAGGGCAAGAGCCAGGTATAGCTCGAGCTATACCTGGCTCTTGCCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005412.4-577s21c1
Sequence:CCGGCTTCGAGTCTATGCCCTATAACTCGAGTTATAGGGCATAGACTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005412.4-541s21c1
Sequence:CCGGGTCTGACGTCAAGCGGATATCCTCGAGGATATCCGCTTGACGTCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005412.4-291s21c1
Sequence:CCGGACAAGTACTCGGAGGGTTATCCTCGAGGATAACCCTCCGAGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005412.4-1334s21c1
Sequence:CCGGCGGAGAGTTGTGGACTTTATACTCGAGTATAAAGTCCACAACTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005412.3-1342s1c1
Sequence:CCGGCCGGAGAGTTGTGGACTTTATCTCGAGATAAAGTCCACAACTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005412.3-958s1c1
Sequence:CCGGCCGAATCAACTTTGCCGTGTTCTCGAGAACACGGCAAAGTTGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005412.3-586s1c1
Sequence:CCGGCTTCGAGTCTATGCCCTATAACTCGAGTTATAGGGCATAGACTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005412.3-1411s1c1
Sequence:CCGGGCTCCAGGATTTCAAATCCTTCTCGAGAAGGATTTGAAATCCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005412.3-734s1c1
Sequence:CCGGGAGGTGTGTGATGAAGTCAAACTCGAGTTTGACTTCATCACACACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005412
VALIDATED
SHMT2 MISSION shRNA shRNA Plasmid DNA
serine hydroxymethyltransferase 2 (mitochondrial)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005412.4-1639s21c1
Sequence:CCGGTAGGGCAAGAGCCAGGTATAGCTCGAGCTATACCTGGCTCTTGCCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005412.4-577s21c1
Sequence:CCGGCTTCGAGTCTATGCCCTATAACTCGAGTTATAGGGCATAGACTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005412.4-541s21c1
Sequence:CCGGGTCTGACGTCAAGCGGATATCCTCGAGGATATCCGCTTGACGTCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005412.4-291s21c1
Sequence:CCGGACAAGTACTCGGAGGGTTATCCTCGAGGATAACCCTCCGAGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005412.4-1334s21c1
Sequence:CCGGCGGAGAGTTGTGGACTTTATACTCGAGTATAAAGTCCACAACTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005412.3-1342s1c1
Sequence:CCGGCCGGAGAGTTGTGGACTTTATCTCGAGATAAAGTCCACAACTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005412.3-958s1c1
Sequence:CCGGCCGAATCAACTTTGCCGTGTTCTCGAGAACACGGCAAAGTTGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005412.3-586s1c1
Sequence:CCGGCTTCGAGTCTATGCCCTATAACTCGAGTTATAGGGCATAGACTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005412.3-1411s1c1
Sequence:CCGGGCTCCAGGATTTCAAATCCTTCTCGAGAAGGATTTGAAATCCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005412.3-734s1c1
Sequence:CCGGGAGGTGTGTGATGAAGTCAAACTCGAGTTTGACTTCATCACACACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005412
VALIDATED
SHMT2 MISSION shRNA Lentiviral Transduction Particles
serine hydroxymethyltransferase 2 (mitochondrial)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005412.4-1639s21c1
Sequence:CCGGTAGGGCAAGAGCCAGGTATAGCTCGAGCTATACCTGGCTCTTGCCCTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005412.4-577s21c1
Sequence:CCGGCTTCGAGTCTATGCCCTATAACTCGAGTTATAGGGCATAGACTCGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005412.4-541s21c1
Sequence:CCGGGTCTGACGTCAAGCGGATATCCTCGAGGATATCCGCTTGACGTCAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005412.4-291s21c1
Sequence:CCGGACAAGTACTCGGAGGGTTATCCTCGAGGATAACCCTCCGAGTACTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005412.4-1334s21c1
Sequence:CCGGCGGAGAGTTGTGGACTTTATACTCGAGTATAAAGTCCACAACTCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005412.3-1342s1c1
Sequence:CCGGCCGGAGAGTTGTGGACTTTATCTCGAGATAAAGTCCACAACTCTCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005412.3-958s1c1
Sequence:CCGGCCGAATCAACTTTGCCGTGTTCTCGAGAACACGGCAAAGTTGATTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005412.3-586s1c1
Sequence:CCGGCTTCGAGTCTATGCCCTATAACTCGAGTTATAGGGCATAGACTCGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005412.3-1411s1c1
Sequence:CCGGGCTCCAGGATTTCAAATCCTTCTCGAGAAGGATTTGAAATCCTGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005412.3-734s1c1
Sequence:CCGGGAGGTGTGTGATGAAGTCAAACTCGAGTTTGACTTCATCACACACCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)