EMAIL THIS PAGE TO A FRIEND

SHOC2

soc-2 suppressor of clear homolog (C. elegans)

176 Gene Product Result for
Synonyms: SIAA0862 SOC2 SUR8
UniProtKB ID: Q9UQ13, A8K9W8, B3KR23, O76063, Q5VZS8, Q5VZS9
Gene ID:
Human(8036) Summary: This gene encodes a protein that consists almost entirely of leucine-rich repeats, a domain implicated in protein-protein interactions. The protein may function as a scaffold linking RAS to downstream signal transducers in the RAS/ERK MAP kinase signaling cascade. Mutations in this gene have been associated with Noonan-like syndrome with loose anagen hair. [provided by RefSeq, May 2010]
Mouse(56392) soc-2 (suppressor of clear) homolog (C. elegans)
Rat(309548) soc-2 (suppressor of clear) homolog (C. elegans)
Zebrafish(555476) soc-2 suppressor of clear homolog (C. elegans)
domestic cat(101094210) soc-2 suppressor of clear homolog (C. elegans)
Horse(100059268) soc-2 suppressor of clear homolog (C. elegans)
dog(477819) soc-2 suppressor of clear homolog (C. elegans)
chicken(423894) soc-2 suppressor of clear homolog (C. elegans)
cow(511417) soc-2 suppressor of clear homolog (C. elegans)
sheep(101120536) soc-2 suppressor of clear homolog (C. elegans)
domestic guinea pig(100720454) soc-2 suppressor of clear homolog (C. elegans)
naked mole-rat(101725341) soc-2 suppressor of clear homolog (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007373 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019658 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019658 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019658 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007373 Rosetta Predictions human pricing
NM_001013155 Rosetta Predictions rat pricing
NM_019658 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154151 predicted 1053
2 SASI_Hs01_00154152 predicted 678
3 SASI_Hs01_00154153 predicted 731
4 SASI_Hs01_00154154 predicted 554
5 SASI_Hs02_00343503 predicted 1662
6 SASI_Hs01_00154156 predicted 1754
7 SASI_Hs01_00154159 predicted 1029
8 SASI_Hs02_00343504 predicted 1453
9 SASI_Hs02_00343505 predicted 1150
10 SASI_Hs02_00343506 predicted 1360
11 SASI_Hs01_00154155 predicted 984
12 SASI_Hs01_00154157 predicted 525
13 SASI_Hs01_00154158 predicted 1544
14 SASI_Hs01_00154160 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057454 predicted 1248
2 SASI_Rn01_00057455 predicted 1728
3 SASI_Rn01_00057456 predicted 541
4 SASI_Rn01_00057457 predicted 811
5 SASI_Rn01_00057458 predicted 366
6 SASI_Rn01_00057459 predicted 745
7 SASI_Rn01_00057461 predicted 1064
8 SASI_Rn01_00057462 predicted 1393
9 SASI_Rn01_00057463 predicted 1560
10 SASI_Rn02_00200884 predicted 1460
11 SASI_Rn01_00057460 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162777 predicted 1649
2 SASI_Mm01_00162778 predicted 1637
3 SASI_Mm01_00162779 predicted 2054
4 SASI_Mm01_00162780 predicted 1557
5 SASI_Mm01_00162782 predicted 1775
6 SASI_Mm01_00162783 predicted 1516
7 SASI_Mm01_00162784 predicted 712
8 SASI_Mm01_00162786 predicted 1575
9 SASI_Mm02_00324707 predicted 1743
10 SASI_Mm02_00324708 predicted 1191
11 SASI_Mm01_00162781 predicted 840
12 SASI_Mm01_00162785 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007373
VALIDATED
SHOC2 MISSION shRNA Bacterial Glycerol Stock
soc-2 suppressor of clear homolog (C. elegans)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000152103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-1476s1c1
Sequence:CCGGCGTTTCTCTTGAGGTTCTTATCTCGAGATAAGAACCTCAAGAGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-1703s1c1
Sequence:CCGGGCCTTGGAGAGAACCTACTTACTCGAGTAAGTAGGTTCTCTCCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-1753s1c1
Sequence:CCGGGAGAACCTAGAAGAACTGTATCTCGAGATACAGTTCTTCTAGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-861s1c1
Sequence:CCGGGCTTAGCATTCGAGAGAACAACTCGAGTTGTTCTCTCGAATGCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-1121s1c1
Sequence:CCGGGCAGTGCACTTGAAGAATTAACTCGAGTTAATTCTTCAAGTGCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007373.2-720s1c1
Sequence:CCGGGATGCTTGATTTACGGCATAACTCGAGTTATGCCGTAAATCAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007373.2-549s1c1
Sequence:CCGGGCCATCATCAATCAAAGAGTTCTCGAGAACTCTTTGATTGATGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007373.2-3208s1c1
Sequence:CCGGGCACATTGCATAGAAGCCATTCTCGAGAATGGCTTCTATGCAATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-858s1c1
Sequence:CCGGCATGCTTAGCATTCGAGAGAACTCGAGTTCTCTCGAATGCTAAGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007373.2-411s1c1
Sequence:CCGGCAATACGATCAAACGGCCAAACTCGAGTTTGGCCGTTTGATCGTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007373
VALIDATED
SHOC2 MISSION shRNA shRNA Plasmid DNA
soc-2 suppressor of clear homolog (C. elegans)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000152103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-1476s1c1
Sequence:CCGGCGTTTCTCTTGAGGTTCTTATCTCGAGATAAGAACCTCAAGAGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-1703s1c1
Sequence:CCGGGCCTTGGAGAGAACCTACTTACTCGAGTAAGTAGGTTCTCTCCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-1753s1c1
Sequence:CCGGGAGAACCTAGAAGAACTGTATCTCGAGATACAGTTCTTCTAGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-861s1c1
Sequence:CCGGGCTTAGCATTCGAGAGAACAACTCGAGTTGTTCTCTCGAATGCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-1121s1c1
Sequence:CCGGGCAGTGCACTTGAAGAATTAACTCGAGTTAATTCTTCAAGTGCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007373.2-720s1c1
Sequence:CCGGGATGCTTGATTTACGGCATAACTCGAGTTATGCCGTAAATCAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007373.2-549s1c1
Sequence:CCGGGCCATCATCAATCAAAGAGTTCTCGAGAACTCTTTGATTGATGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007373.2-3208s1c1
Sequence:CCGGGCACATTGCATAGAAGCCATTCTCGAGAATGGCTTCTATGCAATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-858s1c1
Sequence:CCGGCATGCTTAGCATTCGAGAGAACTCGAGTTCTCTCGAATGCTAAGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007373.2-411s1c1
Sequence:CCGGCAATACGATCAAACGGCCAAACTCGAGTTTGGCCGTTTGATCGTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007373
VALIDATED
SHOC2 MISSION shRNA Lentiviral Transduction Particles
soc-2 suppressor of clear homolog (C. elegans)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000152103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-1476s1c1
Sequence:CCGGCGTTTCTCTTGAGGTTCTTATCTCGAGATAAGAACCTCAAGAGAAACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-1703s1c1
Sequence:CCGGGCCTTGGAGAGAACCTACTTACTCGAGTAAGTAGGTTCTCTCCAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-1753s1c1
Sequence:CCGGGAGAACCTAGAAGAACTGTATCTCGAGATACAGTTCTTCTAGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-861s1c1
Sequence:CCGGGCTTAGCATTCGAGAGAACAACTCGAGTTGTTCTCTCGAATGCTAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-1121s1c1
Sequence:CCGGGCAGTGCACTTGAAGAATTAACTCGAGTTAATTCTTCAAGTGCACTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007373.2-720s1c1
Sequence:CCGGGATGCTTGATTTACGGCATAACTCGAGTTATGCCGTAAATCAAGCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007373.2-549s1c1
Sequence:CCGGGCCATCATCAATCAAAGAGTTCTCGAGAACTCTTTGATTGATGATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007373.2-3208s1c1
Sequence:CCGGGCACATTGCATAGAAGCCATTCTCGAGAATGGCTTCTATGCAATGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_007373.2-858s1c1
Sequence:CCGGCATGCTTAGCATTCGAGAGAACTCGAGTTCTCTCGAATGCTAAGCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007373.2-411s1c1
Sequence:CCGGCAATACGATCAAACGGCCAAACTCGAGTTTGGCCGTTTGATCGTATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019658
VALIDATED
SHOC2 MISSION shRNA Bacterial Glycerol Stock
soc-2 suppressor of clear homolog (C. elegans)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019658.5-945s21c1
Sequence:CCGGCCACTCTCTATCTTCGCTTTACTCGAGTAAAGCGAAGATAGAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019658.5-1577s21c1
Sequence:CCGGGAATTGAATTTAGCGACTAATCTCGAGATTAGTCGCTAAATTCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019658.5-1488s21c1
Sequence:CCGGCCAGAGCTAAAGTGTTAAGTACTCGAGTACTTAACACTTTAGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-2454s1c1
Sequence:CCGGCGGAGTGAATCACTGGATTAACTCGAGTTAATCCAGTGATTCACTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-1357s1c1
Sequence:CCGGCCAGAGCTAAAGTGTTAAGTACTCGAGTACTTAACACTTTAGCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-1922s1c1
Sequence:CCGGGCCTTCGTTCATTATTCAGTTCTCGAGAACTGAATAATGAACGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-814s1c1
Sequence:CCGGCCACTCTCTATCTTCGCTTTACTCGAGTAAAGCGAAGATAGAGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-759s1c1
Sequence:CCGGCGGCATAATAAACTGAGAGAACTCGAGTTCTCTCAGTTTATTATGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019658.5-2053s21c1
Sequence:CCGGGCCTTCGTTCATTATTCAGTTCTCGAGAACTGAATAATGAACGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019658.5-2190s21c1
Sequence:CCGGATTGATCTATGGCAGATTTATCTCGAGATAAATCTGCCATAGATCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019658
VALIDATED
SHOC2 MISSION shRNA shRNA Plasmid DNA
soc-2 suppressor of clear homolog (C. elegans)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019658.5-945s21c1
Sequence:CCGGCCACTCTCTATCTTCGCTTTACTCGAGTAAAGCGAAGATAGAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019658.5-1577s21c1
Sequence:CCGGGAATTGAATTTAGCGACTAATCTCGAGATTAGTCGCTAAATTCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019658.5-1488s21c1
Sequence:CCGGCCAGAGCTAAAGTGTTAAGTACTCGAGTACTTAACACTTTAGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-2454s1c1
Sequence:CCGGCGGAGTGAATCACTGGATTAACTCGAGTTAATCCAGTGATTCACTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-1357s1c1
Sequence:CCGGCCAGAGCTAAAGTGTTAAGTACTCGAGTACTTAACACTTTAGCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-1922s1c1
Sequence:CCGGGCCTTCGTTCATTATTCAGTTCTCGAGAACTGAATAATGAACGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-814s1c1
Sequence:CCGGCCACTCTCTATCTTCGCTTTACTCGAGTAAAGCGAAGATAGAGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-759s1c1
Sequence:CCGGCGGCATAATAAACTGAGAGAACTCGAGTTCTCTCAGTTTATTATGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019658.5-2053s21c1
Sequence:CCGGGCCTTCGTTCATTATTCAGTTCTCGAGAACTGAATAATGAACGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019658.5-2190s21c1
Sequence:CCGGATTGATCTATGGCAGATTTATCTCGAGATAAATCTGCCATAGATCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019658
VALIDATED
SHOC2 MISSION shRNA Lentiviral Transduction Particles
soc-2 suppressor of clear homolog (C. elegans)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019658.5-945s21c1
Sequence:CCGGCCACTCTCTATCTTCGCTTTACTCGAGTAAAGCGAAGATAGAGAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019658.5-1577s21c1
Sequence:CCGGGAATTGAATTTAGCGACTAATCTCGAGATTAGTCGCTAAATTCAATTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019658.5-1488s21c1
Sequence:CCGGCCAGAGCTAAAGTGTTAAGTACTCGAGTACTTAACACTTTAGCTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-2454s1c1
Sequence:CCGGCGGAGTGAATCACTGGATTAACTCGAGTTAATCCAGTGATTCACTCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-1357s1c1
Sequence:CCGGCCAGAGCTAAAGTGTTAAGTACTCGAGTACTTAACACTTTAGCTCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-1922s1c1
Sequence:CCGGGCCTTCGTTCATTATTCAGTTCTCGAGAACTGAATAATGAACGAAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-814s1c1
Sequence:CCGGCCACTCTCTATCTTCGCTTTACTCGAGTAAAGCGAAGATAGAGAGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019658.2-759s1c1
Sequence:CCGGCGGCATAATAAACTGAGAGAACTCGAGTTCTCTCAGTTTATTATGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019658.5-2053s21c1
Sequence:CCGGGCCTTCGTTCATTATTCAGTTCTCGAGAACTGAATAATGAACGAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019658.5-2190s21c1
Sequence:CCGGATTGATCTATGGCAGATTTATCTCGAGATAAATCTGCCATAGATCAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)