EMAIL THIS PAGE TO A FRIEND

SI

sucrase-isomaltase (alpha-glucosidase)

45 Gene Product Result for
UniProtKB ID: P14410, A2RUC3, Q1JQ80, Q1RMC2
Gene ID:
Human(6476) Summary: This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Rat(497756) sucrase-isomaltase (alpha-glucosidase)
Horse(100063242) sucrase-isomaltase (alpha-glucosidase)
chicken(425007) sucrase-isomaltase (alpha-glucosidase)
domestic cat(100144605) sucrase-isomaltase (alpha-glucosidase)
dog(488141) sucrase-isomaltase (alpha-glucosidase)
Zebrafish(100148922) sucrase-isomaltase (alpha-glucosidase)
cow(504366) sucrase-isomaltase (alpha-glucosidase)
sheep(101102774) sucrase-isomaltase (alpha-glucosidase)
Domestic Rabbit(100009093) sucrase-isomaltase (alpha-glucosidase)
naked mole-rat(101711933) sucrase-isomaltase (alpha-glucosidase)
domestic guinea pig(100731286) sucrase-isomaltase (alpha-glucosidase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M1777 N-Methyl-1-deoxynojirimycin ≥98% mouse, rat pricing
D4434 Dichloromethylenediphosphonic acid disodium salt rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001041 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017221 MISSION® esiRNA esiRNA targeting human SI (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001041 Rosetta Predictions human pricing
NM_013061 Rosetta Predictions rat pricing
XM_579366 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067108 predicted 1441
2 SASI_Hs01_00067110 predicted 3024
3 SASI_Hs01_00067111 predicted 5461
4 SASI_Hs01_00067113 predicted 5260
5 SASI_Hs01_00067114 predicted 1254
6 SASI_Hs01_00067115 predicted 4858
7 SASI_Hs02_00309182 predicted 2658
8 SASI_Hs02_00309183 predicted 888
9 SASI_Hs02_00309184 predicted 1425
10 SASI_Hs01_00067116 predicted 1883
11 SASI_Hs01_00067109 predicted 4041
12 SASI_Hs01_00067112 predicted 4454
13 SASI_Hs01_00067117 predicted 3236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068544 predicted 854
2 SASI_Rn01_00068545 predicted 3072
3 SASI_Rn01_00068546 predicted 1442
4 SASI_Rn01_00068547 predicted 3863
5 SASI_Rn01_00068548 predicted 3608
6 SASI_Rn02_00260798 predicted 5659
7 SASI_Rn02_00260799 predicted 3844
8 SASI_Rn01_00068549 predicted 3599
9 SASI_Rn02_00260800 predicted 2798
10 SASI_Rn01_00068550 predicted 1013
11 SASI_Rn01_00068543 predicted 632
12 SASI_Rn01_00068551 predicted 2330
13 SASI_Rn01_00068552 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00192763 predicted 3564
2 SASI_Rn01_00192764 predicted 3621
3 SASI_Rn01_00192765 predicted 3724
4 SASI_Rn01_00192766 predicted 3578
5 SASI_Rn01_00192767 predicted 3548
6 SASI_Rn01_00192768 predicted 3601
7 SASI_Rn01_00192769 predicted 3606
8 SASI_Rn01_00192770 predicted 3693
9 SASI_Rn01_00192771 predicted 3711
10 SASI_Rn01_00192772 predicted 3676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001041
SI MISSION shRNA Bacterial Glycerol Stock
sucrase-isomaltase (alpha-glucosidase)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001041.2-2429s21c1
Sequence:CCGGACATCTTAGAGGAGGTTATATCTCGAGATATAACCTCCTCTAAGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-351s1c1
Sequence:CCGGCCGTGGAATGACTCTCTTATTCTCGAGAATAAGAGAGTCATTCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-4185s1c1
Sequence:CCGGGCCAGAGAAATTGTGGACTTTCTCGAGAAAGTCCACAATTTCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-2992s1c1
Sequence:CCGGCCAGACAAGATAACTCTTATTCTCGAGAATAAGAGTTATCTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-1286s1c1
Sequence:CCGGCCCTCAATTTGTGCAAGATTTCTCGAGAAATCTTGCACAAATTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-4076s1c1
Sequence:CCGGGCCCAACATAACAATAGATAACTCGAGTTATCTATTGTTATGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001041.2-2130s21c1
Sequence:CCGGACTATTCGCTACACCTTATTACTCGAGTAATAAGGTGTAGCGAATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001041.2-1260s21c1
Sequence:CCGGTATGATCAAGTTGCGTTTAACCTCGAGGTTAAACGCAACTTGATCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001041
SI MISSION shRNA shRNA Plasmid DNA
sucrase-isomaltase (alpha-glucosidase)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001041.2-2429s21c1
Sequence:CCGGACATCTTAGAGGAGGTTATATCTCGAGATATAACCTCCTCTAAGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-351s1c1
Sequence:CCGGCCGTGGAATGACTCTCTTATTCTCGAGAATAAGAGAGTCATTCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-4185s1c1
Sequence:CCGGGCCAGAGAAATTGTGGACTTTCTCGAGAAAGTCCACAATTTCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-2992s1c1
Sequence:CCGGCCAGACAAGATAACTCTTATTCTCGAGAATAAGAGTTATCTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-1286s1c1
Sequence:CCGGCCCTCAATTTGTGCAAGATTTCTCGAGAAATCTTGCACAAATTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-4076s1c1
Sequence:CCGGGCCCAACATAACAATAGATAACTCGAGTTATCTATTGTTATGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001041.2-2130s21c1
Sequence:CCGGACTATTCGCTACACCTTATTACTCGAGTAATAAGGTGTAGCGAATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001041.2-1260s21c1
Sequence:CCGGTATGATCAAGTTGCGTTTAACCTCGAGGTTAAACGCAACTTGATCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001041
SI MISSION shRNA Lentiviral Transduction Particles
sucrase-isomaltase (alpha-glucosidase)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001041.2-2429s21c1
Sequence:CCGGACATCTTAGAGGAGGTTATATCTCGAGATATAACCTCCTCTAAGATGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-351s1c1
Sequence:CCGGCCGTGGAATGACTCTCTTATTCTCGAGAATAAGAGAGTCATTCCACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-4185s1c1
Sequence:CCGGGCCAGAGAAATTGTGGACTTTCTCGAGAAAGTCCACAATTTCTCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-2992s1c1
Sequence:CCGGCCAGACAAGATAACTCTTATTCTCGAGAATAAGAGTTATCTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-1286s1c1
Sequence:CCGGCCCTCAATTTGTGCAAGATTTCTCGAGAAATCTTGCACAAATTGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001041.1-4076s1c1
Sequence:CCGGGCCCAACATAACAATAGATAACTCGAGTTATCTATTGTTATGTTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001041.2-2130s21c1
Sequence:CCGGACTATTCGCTACACCTTATTACTCGAGTAATAAGGTGTAGCGAATAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001041.2-1260s21c1
Sequence:CCGGTATGATCAAGTTGCGTTTAACCTCGAGGTTAAACGCAACTTGATCATATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)