EMAIL THIS PAGE TO A FRIEND

SIAH2

siah E3 ubiquitin protein ligase 2

119 Gene Product Result for
Synonyms: hSiah2
UniProtKB ID: O43255, O43270
Gene ID:
Human(6478) Summary: This gene encodes a protein that is a member of the seven in absentia homolog (SIAH) family. The protein is an E3 ligase and is involved in ubiquitination and proteasome-mediated degradation of specific proteins. The activity of this ubiquitin ligase has been implicated in regulating cellular response to hypoxia. [provided by RefSeq, Jul 2008]
Mouse(20439) seven in absentia 2
Rat(140593) siah E3 ubiquitin protein ligase 2
chicken(429164) seven in absentia homolog 2 (Drosophila)
dog(100683719) siah E3 ubiquitin protein ligase 2
Horse(100034000) siah E3 ubiquitin protein ligase 2
cow(785659) siah E3 ubiquitin protein ligase 2
domestic guinea pig(100718979) siah E3 ubiquitin protein ligase 2
naked mole-rat(101699954) siah E3 ubiquitin protein ligase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005067 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005067 Rosetta Predictions human pricing
NM_134457 Rosetta Predictions rat pricing
NM_009174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338886 predicted 1634
2 SASI_Hs02_00338887 predicted 2045
3 SASI_Hs02_00338888 predicted 1933
4 SASI_Hs02_00338889 predicted 1641
5 SASI_Hs02_00338890 predicted 2066
6 SASI_Hs01_00017480 predicted 1384
7 SASI_Hs02_00338891 predicted 1216
8 SASI_Hs02_00338892 predicted 1838
9 SASI_Hs02_00338893 predicted 1821
10 SASI_Hs02_00338894 predicted 1202
11 SASI_Hs01_00017474 predicted 1704
12 SASI_Hs01_00017475 predicted 1744
13 SASI_Hs01_00017476 predicted 1786
14 SASI_Hs01_00017477 predicted 1635
15 SASI_Hs01_00017478 predicted 1227
16 SASI_Hs01_00017479 predicted 1415
17 SASI_Hs01_00017481 predicted 1557
18 SASI_Hs01_00017482 predicted 1396
19 SASI_Hs01_00017483 predicted 1868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109320 predicted 717
2 SASI_Rn01_00109321 predicted 845
3 SASI_Rn01_00109322 predicted 1149
4 SASI_Rn01_00109323 predicted 704
5 SASI_Rn02_00268054 predicted 1177
6 SASI_Rn01_00109324 predicted 1257
7 SASI_Rn01_00109325 predicted 1249
8 SASI_Rn01_00109326 predicted 1002
9 SASI_Rn01_00109328 predicted 1240
10 SASI_Rn01_00109329 predicted 1173
11 SASI_Rn01_00109327 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163325 predicted 1176
2 SASI_Mm01_00163327 predicted 1598
3 SASI_Mm02_00315534 predicted 1175
4 SASI_Mm02_00315535 predicted 1590
5 SASI_Mm01_00163328 predicted 1051
6 SASI_Mm01_00163329 predicted 1525
7 SASI_Mm01_00163330 predicted 1472
8 SASI_Mm01_00163331 predicted 1803
9 SASI_Mm01_00163332 predicted 1444
10 SASI_Mm01_00163333 predicted 1511
11 SASI_Mm01_00163326 predicted 1484
12 SASI_Mm01_00163334 predicted 1377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009174
VALIDATED
SIAH2 MISSION shRNA Bacterial Glycerol Stock
siah E3 ubiquitin protein ligase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009174.3-1255s21c1
Sequence:CCGGCACCACTTCATGCTGGTACTTCTCGAGAAGTACCAGCATGAAGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009174.2-1339s1c1
Sequence:CCGGCGAAAGCAAGCTGAGAACTTTCTCGAGAAAGTTCTCAGCTTGCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009174.2-2063s1c1
Sequence:CCGGCCAGGATCTAAAGGTGCTTTACTCGAGTAAAGCACCTTTAGATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009174.2-1512s1c1
Sequence:CCGGCCTTGGAATCAATGTCACGATCTCGAGATCGTGACATTGATTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009174.2-1255s1c1
Sequence:CCGGCACCACTTCATGCTGGTACTTCTCGAGAAGTACCAGCATGAAGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009174.2-1053s1c1
Sequence:CCGGCATCTGTGAATACCGTCCTTACTCGAGTAAGGACGGTATTCACAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009174.3-1055s21c1
Sequence:CCGGTCTGTGAATACCGTCCTTATTCTCGAGAATAAGGACGGTATTCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009174.3-1512s21c1
Sequence:CCGGCCTTGGAATCAATGTCACGATCTCGAGATCGTGACATTGATTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009174.3-1929s21c1
Sequence:CCGGACCTTTCAGGCTGGGTATTTACTCGAGTAAATACCCAGCCTGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009174
VALIDATED
SIAH2 MISSION shRNA shRNA Plasmid DNA
siah E3 ubiquitin protein ligase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009174.3-1255s21c1
Sequence:CCGGCACCACTTCATGCTGGTACTTCTCGAGAAGTACCAGCATGAAGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009174.2-1339s1c1
Sequence:CCGGCGAAAGCAAGCTGAGAACTTTCTCGAGAAAGTTCTCAGCTTGCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009174.2-2063s1c1
Sequence:CCGGCCAGGATCTAAAGGTGCTTTACTCGAGTAAAGCACCTTTAGATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009174.2-1512s1c1
Sequence:CCGGCCTTGGAATCAATGTCACGATCTCGAGATCGTGACATTGATTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009174.2-1255s1c1
Sequence:CCGGCACCACTTCATGCTGGTACTTCTCGAGAAGTACCAGCATGAAGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009174.2-1053s1c1
Sequence:CCGGCATCTGTGAATACCGTCCTTACTCGAGTAAGGACGGTATTCACAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009174.3-1055s21c1
Sequence:CCGGTCTGTGAATACCGTCCTTATTCTCGAGAATAAGGACGGTATTCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009174.3-1512s21c1
Sequence:CCGGCCTTGGAATCAATGTCACGATCTCGAGATCGTGACATTGATTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009174.3-1929s21c1
Sequence:CCGGACCTTTCAGGCTGGGTATTTACTCGAGTAAATACCCAGCCTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009174
VALIDATED
SIAH2 MISSION shRNA Lentiviral Transduction Particles
siah E3 ubiquitin protein ligase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009174.3-1255s21c1
Sequence:CCGGCACCACTTCATGCTGGTACTTCTCGAGAAGTACCAGCATGAAGTGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009174.2-1339s1c1
Sequence:CCGGCGAAAGCAAGCTGAGAACTTTCTCGAGAAAGTTCTCAGCTTGCTTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009174.2-2063s1c1
Sequence:CCGGCCAGGATCTAAAGGTGCTTTACTCGAGTAAAGCACCTTTAGATCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009174.2-1512s1c1
Sequence:CCGGCCTTGGAATCAATGTCACGATCTCGAGATCGTGACATTGATTCCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009174.2-1255s1c1
Sequence:CCGGCACCACTTCATGCTGGTACTTCTCGAGAAGTACCAGCATGAAGTGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009174.2-1053s1c1
Sequence:CCGGCATCTGTGAATACCGTCCTTACTCGAGTAAGGACGGTATTCACAGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009174.3-1055s21c1
Sequence:CCGGTCTGTGAATACCGTCCTTATTCTCGAGAATAAGGACGGTATTCACAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009174.3-1512s21c1
Sequence:CCGGCCTTGGAATCAATGTCACGATCTCGAGATCGTGACATTGATTCCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009174.3-1929s21c1
Sequence:CCGGACCTTTCAGGCTGGGTATTTACTCGAGTAAATACCCAGCCTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005067
VALIDATED
SIAH2 MISSION shRNA Bacterial Glycerol Stock
siah E3 ubiquitin protein ligase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005067.4-1762s1c1
Sequence:CCGGGCTGGCTAATAGACACTGAATCTCGAGATTCAGTGTCTATTAGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005067.4-780s1c1
Sequence:CCGGCATACGGAGAAACCAGAACATCTCGAGATGTTCTGGTTTCTCCGTATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005067.4-1228s1c1
Sequence:CCGGACACAGCCATAGCACATCTTTCTCGAGAAAGATGTGCTATGGCTGTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005067.4-359s1c1
Sequence:CCGGCGCTAATAAACCCTGCAGCAACTCGAGTTGCTGCAGGGTTTATTAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005067.4-1113s1c1
Sequence:CCGGGCCTACAGACTGGAGTTGAATCTCGAGATTCAACTCCAGTCTGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005067.5-1597s21c1
Sequence:CCGGCCATGATGTGACTTTCGTAAACTCGAGTTTACGAAAGTCACATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005067.5-1526s21c1
Sequence:CCGGACACAGCCATAGCACATCTTTCTCGAGAAAGATGTGCTATGGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005067.5-2059s21c1
Sequence:CCGGGCTGGCTAATAGACACTGAATCTCGAGATTCAGTGTCTATTAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005067.5-1078s21c1
Sequence:CCGGCATACGGAGAAACCAGAACATCTCGAGATGTTCTGGTTTCTCCGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005067
VALIDATED
SIAH2 MISSION shRNA shRNA Plasmid DNA
siah E3 ubiquitin protein ligase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005067.4-1762s1c1
Sequence:CCGGGCTGGCTAATAGACACTGAATCTCGAGATTCAGTGTCTATTAGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005067.4-780s1c1
Sequence:CCGGCATACGGAGAAACCAGAACATCTCGAGATGTTCTGGTTTCTCCGTATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005067.4-1228s1c1
Sequence:CCGGACACAGCCATAGCACATCTTTCTCGAGAAAGATGTGCTATGGCTGTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005067.4-359s1c1
Sequence:CCGGCGCTAATAAACCCTGCAGCAACTCGAGTTGCTGCAGGGTTTATTAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005067.4-1113s1c1
Sequence:CCGGGCCTACAGACTGGAGTTGAATCTCGAGATTCAACTCCAGTCTGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005067.5-1597s21c1
Sequence:CCGGCCATGATGTGACTTTCGTAAACTCGAGTTTACGAAAGTCACATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005067.5-1526s21c1
Sequence:CCGGACACAGCCATAGCACATCTTTCTCGAGAAAGATGTGCTATGGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005067.5-2059s21c1
Sequence:CCGGGCTGGCTAATAGACACTGAATCTCGAGATTCAGTGTCTATTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005067.5-1078s21c1
Sequence:CCGGCATACGGAGAAACCAGAACATCTCGAGATGTTCTGGTTTCTCCGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005067
VALIDATED
SIAH2 MISSION shRNA Lentiviral Transduction Particles
siah E3 ubiquitin protein ligase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005067.4-1762s1c1
Sequence:CCGGGCTGGCTAATAGACACTGAATCTCGAGATTCAGTGTCTATTAGCCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005067.4-780s1c1
Sequence:CCGGCATACGGAGAAACCAGAACATCTCGAGATGTTCTGGTTTCTCCGTATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005067.4-1228s1c1
Sequence:CCGGACACAGCCATAGCACATCTTTCTCGAGAAAGATGTGCTATGGCTGTGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005067.4-359s1c1
Sequence:CCGGCGCTAATAAACCCTGCAGCAACTCGAGTTGCTGCAGGGTTTATTAGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005067.4-1113s1c1
Sequence:CCGGGCCTACAGACTGGAGTTGAATCTCGAGATTCAACTCCAGTCTGTAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005067.5-1597s21c1
Sequence:CCGGCCATGATGTGACTTTCGTAAACTCGAGTTTACGAAAGTCACATCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005067.5-1526s21c1
Sequence:CCGGACACAGCCATAGCACATCTTTCTCGAGAAAGATGTGCTATGGCTGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005067.5-2059s21c1
Sequence:CCGGGCTGGCTAATAGACACTGAATCTCGAGATTCAGTGTCTATTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005067.5-1078s21c1
Sequence:CCGGCATACGGAGAAACCAGAACATCTCGAGATGTTCTGGTTTCTCCGTATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)