EMAIL THIS PAGE TO A FRIEND

SIDT2

SID1 transmembrane family, member 2

68 Gene Product Result for
UniProtKB ID: Q8NBJ9, Q8NBY7, Q9Y357
Gene ID:
Mouse(214597) SID1 transmembrane family, member 2
Rat(315617) SID1 transmembrane family, member 2
Zebrafish(796833) SID1 transmembrane family, member 2
chicken(770233) SID1 transmembrane family, member 2
Horse(100062652) SID1 transmembrane family, member 2
domestic cat(101081572) SID1 transmembrane family, member 2
dog(489391) SID1 transmembrane family, member 2
naked mole-rat(101698146) SID1 transmembrane family, member 2
domestic guinea pig(100731389) SID1 transmembrane family, member 2
cow(513462) SID1 transmembrane family, member 2
sheep(101118299) SID1 transmembrane family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172257 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172257 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172257 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001040455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040455 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015996 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040455 Rosetta Predictions human pricing
NM_001108142 Rosetta Predictions rat pricing
XM_236205 Rosetta Predictions rat pricing
NM_172257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308997 predicted 681
2 SASI_Hs01_00037299 predicted 1769
3 SASI_Hs02_00308998 predicted 1754
4 SASI_Hs01_00037300 predicted 1468
5 SASI_Hs01_00037301 predicted 521
6 SASI_Hs01_00037303 predicted 942
7 SASI_Hs01_00037304 predicted 2588
8 SASI_Hs01_00037305 predicted 2499
9 SASI_Hs02_00308999 predicted 2215
10 SASI_Hs01_00037306 predicted 625
11 SASI_Hs01_00037302 predicted 1408
12 SASI_Hs01_00037307 predicted 1527
13 SASI_Hs01_00037308 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235774 predicted 1295
2 SASI_Rn02_00235775 predicted 1728
3 SASI_Rn02_00235776 predicted 884
4 SASI_Rn02_00235777 predicted 3104
5 SASI_Rn02_00235778 predicted 2215
6 SASI_Rn02_00235779 predicted 1592
7 SASI_Rn02_00235780 predicted 1874
8 SASI_Rn02_00235781 predicted 1720
9 SASI_Rn02_00235782 predicted 3007
10 SASI_Rn02_00235783 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170800 predicted 862
2 SASI_Rn01_00170801 predicted 1292
3 SASI_Rn01_00170802 predicted 451
4 SASI_Rn01_00170803 predicted 2667
5 SASI_Rn01_00170804 predicted 1779
6 SASI_Rn01_00170805 predicted 1164
7 SASI_Rn01_00170806 predicted 1433
8 SASI_Rn01_00170807 predicted 1285
9 SASI_Rn01_00170808 predicted 2575
10 SASI_Rn01_00170809 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099744 predicted 407
2 SASI_Mm01_00099745 predicted 1255
3 SASI_Mm01_00099746 predicted 625
4 SASI_Mm01_00099747 predicted 2563
5 SASI_Mm01_00099748 predicted 1244
6 SASI_Mm01_00099750 predicted 1411
7 SASI_Mm01_00099751 predicted 2235
8 SASI_Mm01_00099752 predicted 1779
9 SASI_Mm01_00099753 predicted 1239
10 SASI_Mm02_00343722 predicted 2516
11 SASI_Mm01_00099749 predicted 1942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172257
VALIDATED
SIDT2 MISSION shRNA Bacterial Glycerol Stock
SID1 transmembrane family, member 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172257.3-1646s21c1
Sequence:CCGGGCACGAAAGGACAAACGTGTTCTCGAGAACACGTTTGTCCTTTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172257.3-1906s21c1
Sequence:CCGGGCAGCGAGAGATCAATCATAACTCGAGTTATGATTGATCTCTCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172257.3-2071s21c1
Sequence:CCGGCCAGTTTGATACCTCCTTCATCTCGAGATGAAGGAGGTATCAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172257.3-3862s21c1
Sequence:CCGGCGTCCAGTATTTAGCCAAGTTCTCGAGAACTTGGCTAAATACTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172257.1-1247s1c1
Sequence:CCGGCCTGGGCATATTCTTGTCCTTCTCGAGAAGGACAAGAATATGCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-1650s1c1
Sequence:CCGGGCACGAAAGGACAAACGTGTTCTCGAGAACACGTTTGTCCTTTCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-2075s1c1
Sequence:CCGGCCAGTTTGATACCTCCTTCATCTCGAGATGAAGGAGGTATCAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-3866s1c1
Sequence:CCGGCGTCCAGTATTTAGCCAAGTTCTCGAGAACTTGGCTAAATACTGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172257.3-631s1c1
Sequence:CCGGCCTAATCCTTCGAGGACTATACTCGAGTATAGTCCTCGAAGGATTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172257.1-1682s1c1
Sequence:CCGGGTACCAGATTTACTTCTGGAACTCGAGTTCCAGAAGTAAATCTGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-1910s1c1
Sequence:CCGGGCAGCGAGAGATCAATCATAACTCGAGTTATGATTGATCTCTCGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-4003s1c1
Sequence:CCGGCTTTGGTACTTGGTTGCCCTTCTCGAGAAGGGCAACCAAGTACCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172257
VALIDATED
SIDT2 MISSION shRNA shRNA Plasmid DNA
SID1 transmembrane family, member 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172257.3-1646s21c1
Sequence:CCGGGCACGAAAGGACAAACGTGTTCTCGAGAACACGTTTGTCCTTTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172257.3-1906s21c1
Sequence:CCGGGCAGCGAGAGATCAATCATAACTCGAGTTATGATTGATCTCTCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172257.3-2071s21c1
Sequence:CCGGCCAGTTTGATACCTCCTTCATCTCGAGATGAAGGAGGTATCAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172257.3-3862s21c1
Sequence:CCGGCGTCCAGTATTTAGCCAAGTTCTCGAGAACTTGGCTAAATACTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172257.1-1247s1c1
Sequence:CCGGCCTGGGCATATTCTTGTCCTTCTCGAGAAGGACAAGAATATGCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-1650s1c1
Sequence:CCGGGCACGAAAGGACAAACGTGTTCTCGAGAACACGTTTGTCCTTTCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-2075s1c1
Sequence:CCGGCCAGTTTGATACCTCCTTCATCTCGAGATGAAGGAGGTATCAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-3866s1c1
Sequence:CCGGCGTCCAGTATTTAGCCAAGTTCTCGAGAACTTGGCTAAATACTGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172257.3-631s1c1
Sequence:CCGGCCTAATCCTTCGAGGACTATACTCGAGTATAGTCCTCGAAGGATTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172257.1-1682s1c1
Sequence:CCGGGTACCAGATTTACTTCTGGAACTCGAGTTCCAGAAGTAAATCTGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-1910s1c1
Sequence:CCGGGCAGCGAGAGATCAATCATAACTCGAGTTATGATTGATCTCTCGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-4003s1c1
Sequence:CCGGCTTTGGTACTTGGTTGCCCTTCTCGAGAAGGGCAACCAAGTACCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172257
VALIDATED
SIDT2 MISSION shRNA Lentiviral Transduction Particles
SID1 transmembrane family, member 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172257.3-1646s21c1
Sequence:CCGGGCACGAAAGGACAAACGTGTTCTCGAGAACACGTTTGTCCTTTCGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172257.3-1906s21c1
Sequence:CCGGGCAGCGAGAGATCAATCATAACTCGAGTTATGATTGATCTCTCGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172257.3-2071s21c1
Sequence:CCGGCCAGTTTGATACCTCCTTCATCTCGAGATGAAGGAGGTATCAAACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172257.3-3862s21c1
Sequence:CCGGCGTCCAGTATTTAGCCAAGTTCTCGAGAACTTGGCTAAATACTGGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172257.1-1247s1c1
Sequence:CCGGCCTGGGCATATTCTTGTCCTTCTCGAGAAGGACAAGAATATGCCCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-1650s1c1
Sequence:CCGGGCACGAAAGGACAAACGTGTTCTCGAGAACACGTTTGTCCTTTCGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-2075s1c1
Sequence:CCGGCCAGTTTGATACCTCCTTCATCTCGAGATGAAGGAGGTATCAAACTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-3866s1c1
Sequence:CCGGCGTCCAGTATTTAGCCAAGTTCTCGAGAACTTGGCTAAATACTGGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172257.3-631s1c1
Sequence:CCGGCCTAATCCTTCGAGGACTATACTCGAGTATAGTCCTCGAAGGATTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172257.1-1682s1c1
Sequence:CCGGGTACCAGATTTACTTCTGGAACTCGAGTTCCAGAAGTAAATCTGGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-1910s1c1
Sequence:CCGGGCAGCGAGAGATCAATCATAACTCGAGTTATGATTGATCTCTCGCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172257.1-4003s1c1
Sequence:CCGGCTTTGGTACTTGGTTGCCCTTCTCGAGAAGGGCAACCAAGTACCAAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040455
VALIDATED
SIDT2 MISSION shRNA Bacterial Glycerol Stock
SID1 transmembrane family, member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000285471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040455.1-1769s21c1
Sequence:CCGGCCAGTTTGACACATCGTTCATCTCGAGATGAACGATGTGTCAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040455.1-1311s21c1
Sequence:CCGGCGCACCAAGCAATACCTCTATCTCGAGATAGAGGTATTGCTTGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040455.1-1260s21c1
Sequence:CCGGGAGGATGACTACGACACATTGCTCGAGCAATGTGTCGTAGTCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040455.1-2987s21c1
Sequence:CCGGCCTGAATCTCTGTCCTGTATCCTCGAGGATACAGGACAGAGATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040455
VALIDATED
SIDT2 MISSION shRNA shRNA Plasmid DNA
SID1 transmembrane family, member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000285471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040455.1-1769s21c1
Sequence:CCGGCCAGTTTGACACATCGTTCATCTCGAGATGAACGATGTGTCAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040455.1-1311s21c1
Sequence:CCGGCGCACCAAGCAATACCTCTATCTCGAGATAGAGGTATTGCTTGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040455.1-1260s21c1
Sequence:CCGGGAGGATGACTACGACACATTGCTCGAGCAATGTGTCGTAGTCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040455.1-2987s21c1
Sequence:CCGGCCTGAATCTCTGTCCTGTATCCTCGAGGATACAGGACAGAGATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040455
VALIDATED
SIDT2 MISSION shRNA Lentiviral Transduction Particles
SID1 transmembrane family, member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000285471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040455.1-1769s21c1
Sequence:CCGGCCAGTTTGACACATCGTTCATCTCGAGATGAACGATGTGTCAAACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040455.1-1311s21c1
Sequence:CCGGCGCACCAAGCAATACCTCTATCTCGAGATAGAGGTATTGCTTGGTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040455.1-1260s21c1
Sequence:CCGGGAGGATGACTACGACACATTGCTCGAGCAATGTGTCGTAGTCATCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040455.1-2987s21c1
Sequence:CCGGCCTGAATCTCTGTCCTGTATCCTCGAGGATACAGGACAGAGATTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015996
VALIDATED
SIDT2 MISSION shRNA Bacterial Glycerol Stock
SID1 transmembrane family, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015996.1-2836s1c1
Sequence:CCGGCACACATACCTATGAAACCTTCTCGAGAAGGTTTCATAGGTATGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_015996.1-1485s1c1
Sequence:CCGGCAGATCTACTTCTGGAACATTCTCGAGAATGTTCCAGAAGTAGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015996.1-2822s1c1
Sequence:CCGGGTGTTAGTCATGCACACACATCTCGAGATGTGTGTGCATGACTAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015996.1-1874s1c1
Sequence:CCGGCCAGTTTGACACATCGTTCATCTCGAGATGAACGATGTGTCAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015996.1-1416s1c1
Sequence:CCGGCGCACCAAGCAATACCTCTATCTCGAGATAGAGGTATTGCTTGGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015996.1-596s1c1
Sequence:CCGGCCAGTACTTCAAGTATGAGTTCTCGAGAACTCATACTTGAAGTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015996.1-1484s1c1
Sequence:CCGGCCAGATCTACTTCTGGAACATCTCGAGATGTTCCAGAAGTAGATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015996
VALIDATED
SIDT2 MISSION shRNA shRNA Plasmid DNA
SID1 transmembrane family, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015996.1-2836s1c1
Sequence:CCGGCACACATACCTATGAAACCTTCTCGAGAAGGTTTCATAGGTATGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_015996.1-1485s1c1
Sequence:CCGGCAGATCTACTTCTGGAACATTCTCGAGAATGTTCCAGAAGTAGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015996.1-2822s1c1
Sequence:CCGGGTGTTAGTCATGCACACACATCTCGAGATGTGTGTGCATGACTAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015996.1-1874s1c1
Sequence:CCGGCCAGTTTGACACATCGTTCATCTCGAGATGAACGATGTGTCAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015996.1-1416s1c1
Sequence:CCGGCGCACCAAGCAATACCTCTATCTCGAGATAGAGGTATTGCTTGGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015996.1-596s1c1
Sequence:CCGGCCAGTACTTCAAGTATGAGTTCTCGAGAACTCATACTTGAAGTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015996.1-1484s1c1
Sequence:CCGGCCAGATCTACTTCTGGAACATCTCGAGATGTTCCAGAAGTAGATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015996
VALIDATED
SIDT2 MISSION shRNA Lentiviral Transduction Particles
SID1 transmembrane family, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015996.1-2836s1c1
Sequence:CCGGCACACATACCTATGAAACCTTCTCGAGAAGGTTTCATAGGTATGTGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_015996.1-1485s1c1
Sequence:CCGGCAGATCTACTTCTGGAACATTCTCGAGAATGTTCCAGAAGTAGATCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015996.1-2822s1c1
Sequence:CCGGGTGTTAGTCATGCACACACATCTCGAGATGTGTGTGCATGACTAACACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015996.1-1874s1c1
Sequence:CCGGCCAGTTTGACACATCGTTCATCTCGAGATGAACGATGTGTCAAACTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015996.1-1416s1c1
Sequence:CCGGCGCACCAAGCAATACCTCTATCTCGAGATAGAGGTATTGCTTGGTGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_015996.1-596s1c1
Sequence:CCGGCCAGTACTTCAAGTATGAGTTCTCGAGAACTCATACTTGAAGTACTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015996.1-1484s1c1
Sequence:CCGGCCAGATCTACTTCTGGAACATCTCGAGATGTTCCAGAAGTAGATCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)