EMAIL THIS PAGE TO A FRIEND

SIGLEC12

sialic acid binding Ig-like lectin 12 (gene/pseudogene)

29 Gene Product Result for
Synonyms: S2V SIGLECL1 SLG Siglec-XII
UniProtKB ID: Q96PQ1, Q8IYH7
Gene ID:
Human(89858) Summary: Sialic acid-binding immunoglobulin-like lectins (SIGLECs) are a family of cell surface proteins belonging to the immunoglobulin superfamily. They mediate protein-carbohydrate interactions by selectively binding to different sialic acid moieties present on glycolipids and glycoproteins. This gene encodes a member of the SIGLEC3-like subfamily of SIGLECs. Members of this subfamily are characterized by an extracellular V-set immunoglobulin-like domain followed by two C2-set immunoglobulin-like domains, and the cytoplasmic tyrosine-based motifs ITIM and SLAM-like. The encoded protein, upon tyrosine phosphorylation, has been shown to recruit the Src homology 2 domain-containing protein-tyrosine phosphatases SHP1 and SHP2. It has been suggested that the protein is involved in the negative regulation of macrophage signaling by functioning as an inhibitory receptor. This gene is located in a cluster with other SIGLEC3-like genes on 19q13.4. Alternatively spliced transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
dog(484344) sialic acid binding Ig-like lectin 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053003 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037261 MISSION® esiRNA esiRNA human SIGLEC12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033329 Rosetta Predictions human pricing
NM_053003 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099691 predicted 800
2 SASI_Hs01_00099692 predicted 421
3 SASI_Hs01_00099693 predicted 812
4 SASI_Hs01_00099694 predicted 1131
5 SASI_Hs01_00099695 predicted 962
6 SASI_Hs01_00099697 predicted 421
7 SASI_Hs01_00099699 predicted 922
8 SASI_Hs01_00099700 predicted 799
9 SASI_Hs02_00361179 predicted 1216
10 SASI_Hs02_00361180 predicted 1217
11 SASI_Hs01_00099696 predicted 1019
12 SASI_Hs01_00099698 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203705 predicted 1188
2 SASI_Hs01_00203706 predicted 809
3 SASI_Hs01_00203707 predicted 1202
4 SASI_Hs01_00203708 predicted 1519
5 SASI_Hs01_00203709 predicted 1354
6 SASI_Hs01_00203711 predicted 813
7 SASI_Hs01_00203713 predicted 1321
8 SASI_Hs01_00203714 predicted 1189
9 SASI_Hs02_00361833 predicted 1609
10 SASI_Hs02_00361834 predicted 1610
11 SASI_Hs01_00203710 predicted 1408
12 SASI_Hs01_00203712 predicted 807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053003
SIGLEC12 MISSION shRNA Bacterial Glycerol Stock
sialic acid binding Ig-like lectin 12 (gene/pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053003.2-1902s1c1
Sequence:CCGGCGAGACTGATTCCTTTAGAATCTCGAGATTCTAAAGGAATCAGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053003.2-817s1c1
Sequence:CCGGGCAGGAAATGGAACTACATATCTCGAGATATGTAGTTCCATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053003.2-1191s1c1
Sequence:CCGGGCATCCACAACCTTGAGGAATCTCGAGATTCCTCAAGGTTGTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053003.2-488s1c1
Sequence:CCGGCCAGGACCTACTGTCAAGATACTCGAGTATCTTGACAGTAGGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053003.2-1128s1c1
Sequence:CCGGCGACTCAACATATCCTATCCTCTCGAGAGGATAGGATATGTTGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053003
SIGLEC12 MISSION shRNA shRNA Plasmid DNA
sialic acid binding Ig-like lectin 12 (gene/pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053003.2-1902s1c1
Sequence:CCGGCGAGACTGATTCCTTTAGAATCTCGAGATTCTAAAGGAATCAGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053003.2-817s1c1
Sequence:CCGGGCAGGAAATGGAACTACATATCTCGAGATATGTAGTTCCATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053003.2-1191s1c1
Sequence:CCGGGCATCCACAACCTTGAGGAATCTCGAGATTCCTCAAGGTTGTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053003.2-488s1c1
Sequence:CCGGCCAGGACCTACTGTCAAGATACTCGAGTATCTTGACAGTAGGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053003.2-1128s1c1
Sequence:CCGGCGACTCAACATATCCTATCCTCTCGAGAGGATAGGATATGTTGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053003
SIGLEC12 MISSION shRNA Lentiviral Transduction Particles
sialic acid binding Ig-like lectin 12 (gene/pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053003.2-1902s1c1
Sequence:CCGGCGAGACTGATTCCTTTAGAATCTCGAGATTCTAAAGGAATCAGTCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053003.2-817s1c1
Sequence:CCGGGCAGGAAATGGAACTACATATCTCGAGATATGTAGTTCCATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053003.2-1191s1c1
Sequence:CCGGGCATCCACAACCTTGAGGAATCTCGAGATTCCTCAAGGTTGTGGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053003.2-488s1c1
Sequence:CCGGCCAGGACCTACTGTCAAGATACTCGAGTATCTTGACAGTAGGTCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053003.2-1128s1c1
Sequence:CCGGCGACTCAACATATCCTATCCTCTCGAGAGGATAGGATATGTTGAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)