EMAIL THIS PAGE TO A FRIEND

SIGLEC1

sialic acid binding Ig-like lectin 1, sialoadhesin

127 Gene Product Result for
Synonyms: CD169 SIGLEC-1 SN dJ1009E24.1
UniProtKB ID: Q9BZZ2, Q96DL4, Q9GZS5, Q9H1H6, Q9H1H7, Q9H7L7
Gene ID:
Human(6614) Summary: This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a lectin-like adhesion molecule that binds glycoconjugate ligands on cell surfaces in a sialic acid-dependent manner. It is a type I transmembrane protein expressed only by a subpopulation of macrophages and is involved in mediating cell-cell interactions. Alternative splicing produces a transcript variant encoding an isoform that is soluble rather than membrane-bound; however, the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
Mouse(20612) sialic acid binding Ig-like lectin 1, sialoadhesin
Rat(311426) sialic acid binding Ig-like lectin 1, sialoadhesin
Horse(100066351) sialic acid binding Ig-like lectin 1, sialoadhesin
dog(485794) sialic acid binding Ig-like lectin 1, sialoadhesin
domestic cat(101093264) sialic acid binding Ig-like lectin 1, sialoadhesin
naked mole-rat(101698560) sialic acid binding Ig-like lectin 1, sialoadhesin
Domestic Rabbit(100345836) sialic acid binding Ig-like lectin 1, sialoadhesin
domestic guinea pig(100713768) sialic acid binding Ig-like lectin 1, sialoadhesin
cow(539759) sialic acid binding Ig-like lectin 1, sialoadhesin
sheep(101110959) sialic acid binding Ig-like lectin 1, sialoadhesin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023068 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023068 Rosetta Predictions human pricing
NM_001107777 Rosetta Predictions rat pricing
NM_011426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189978 predicted 2957
2 SASI_Hs01_00189979 predicted 676
3 SASI_Hs01_00189980 predicted 1141
4 SASI_Hs02_00356307 predicted 2287
5 SASI_Hs01_00189981 predicted 1373
6 SASI_Hs01_00189983 predicted 3181
7 SASI_Hs01_00189984 predicted 4605
8 SASI_Hs01_00189985 predicted 545
9 SASI_Hs01_00189986 predicted 2631
10 SASI_Hs01_00189987 predicted 1039
11 SASI_Hs01_00189982 predicted 4260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232165 predicted 4306
2 SASI_Rn02_00232166 predicted 1936
3 SASI_Rn02_00232167 predicted 3518
4 SASI_Rn02_00232168 predicted 5149
5 SASI_Rn02_00232169 predicted 5463
6 SASI_Rn02_00232170 predicted 1632
7 SASI_Rn02_00232171 predicted 1462
8 SASI_Rn02_00232172 predicted 1508
9 SASI_Rn02_00232173 predicted 2738
10 SASI_Rn02_00232174 predicted 3866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042034 predicted 2105
2 SASI_Mm02_00320646 predicted 4975
3 SASI_Mm01_00042035 predicted 3733
4 SASI_Mm01_00042037 predicted 1813
5 SASI_Mm02_00320647 predicted 770
6 SASI_Mm01_00042038 predicted 1733
7 SASI_Mm01_00042039 predicted 3240
8 SASI_Mm01_00042040 predicted 5657
9 SASI_Mm01_00042041 predicted 2721
10 SASI_Mm01_00042042 predicted 2154
11 SASI_Mm01_00042033 predicted 4952
12 SASI_Mm01_00042036 predicted 2788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023068
SIGLEC1 MISSION shRNA Bacterial Glycerol Stock
sialic acid binding Ig-like lectin 1, sialoadhesin
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023068.3-5564s21c1
Sequence:CCGGGACTTCAACATGATAGAATTTCTCGAGAAATTCTATCATGTTGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-1012s1c1
Sequence:CCGGGAGAACCAGACAGTGACACTACTCGAGTAGTGTCACTGTCTGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-2018s1c1
Sequence:CCGGGTGTGGAGATTCACAACCCTTCTCGAGAAGGGTTGTGAATCTCCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-2295s1c1
Sequence:CCGGCAGAACTGATGCTGCCCTTTACTCGAGTAAAGGGCAGCATCAGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-348s1c1
Sequence:CCGGCTTCGAGATCAGTGAGGTCAACTCGAGTTGACCTCACTGATCTCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023068.3-4832s21c1
Sequence:CCGGACATCTGTTCTGCCTCAAATGCTCGAGCATTTGAGGCAGAACAGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023068.3-5539s21c1
Sequence:CCGGGCTCTAACAAGAGACCAAATACTCGAGTATTTGGTCTCTTGTTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023068.3-2222s21c1
Sequence:CCGGACTTCTCCTGGTTCCGAAATGCTCGAGCATTTCGGAACCAGGAGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-4425s1c1
Sequence:CCGGCAACTCCACCTTTGCATGGTTCTCGAGAACCATGCAAAGGTGGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-4253s1c1
Sequence:CCGGCAGGTGATGACACCTATGTTTCTCGAGAAACATAGGTGTCATCACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-2842s1c1
Sequence:CCGGGCAGCCATAACTTTGACACAACTCGAGTTGTGTCAAAGTTATGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-813s1c1
Sequence:CCGGCAGTTCCATTAAGTGGCTCAACTCGAGTTGAGCCACTTAATGGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023068
SIGLEC1 MISSION shRNA shRNA Plasmid DNA
sialic acid binding Ig-like lectin 1, sialoadhesin
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023068.3-5564s21c1
Sequence:CCGGGACTTCAACATGATAGAATTTCTCGAGAAATTCTATCATGTTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-1012s1c1
Sequence:CCGGGAGAACCAGACAGTGACACTACTCGAGTAGTGTCACTGTCTGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-2018s1c1
Sequence:CCGGGTGTGGAGATTCACAACCCTTCTCGAGAAGGGTTGTGAATCTCCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-2295s1c1
Sequence:CCGGCAGAACTGATGCTGCCCTTTACTCGAGTAAAGGGCAGCATCAGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-348s1c1
Sequence:CCGGCTTCGAGATCAGTGAGGTCAACTCGAGTTGACCTCACTGATCTCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023068.3-4832s21c1
Sequence:CCGGACATCTGTTCTGCCTCAAATGCTCGAGCATTTGAGGCAGAACAGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023068.3-5539s21c1
Sequence:CCGGGCTCTAACAAGAGACCAAATACTCGAGTATTTGGTCTCTTGTTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023068.3-2222s21c1
Sequence:CCGGACTTCTCCTGGTTCCGAAATGCTCGAGCATTTCGGAACCAGGAGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-4425s1c1
Sequence:CCGGCAACTCCACCTTTGCATGGTTCTCGAGAACCATGCAAAGGTGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-4253s1c1
Sequence:CCGGCAGGTGATGACACCTATGTTTCTCGAGAAACATAGGTGTCATCACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-2842s1c1
Sequence:CCGGGCAGCCATAACTTTGACACAACTCGAGTTGTGTCAAAGTTATGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-813s1c1
Sequence:CCGGCAGTTCCATTAAGTGGCTCAACTCGAGTTGAGCCACTTAATGGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023068
SIGLEC1 MISSION shRNA Lentiviral Transduction Particles
sialic acid binding Ig-like lectin 1, sialoadhesin
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023068.3-5564s21c1
Sequence:CCGGGACTTCAACATGATAGAATTTCTCGAGAAATTCTATCATGTTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-1012s1c1
Sequence:CCGGGAGAACCAGACAGTGACACTACTCGAGTAGTGTCACTGTCTGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-2018s1c1
Sequence:CCGGGTGTGGAGATTCACAACCCTTCTCGAGAAGGGTTGTGAATCTCCACACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-2295s1c1
Sequence:CCGGCAGAACTGATGCTGCCCTTTACTCGAGTAAAGGGCAGCATCAGTTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-348s1c1
Sequence:CCGGCTTCGAGATCAGTGAGGTCAACTCGAGTTGACCTCACTGATCTCGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023068.3-4832s21c1
Sequence:CCGGACATCTGTTCTGCCTCAAATGCTCGAGCATTTGAGGCAGAACAGATGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023068.3-5539s21c1
Sequence:CCGGGCTCTAACAAGAGACCAAATACTCGAGTATTTGGTCTCTTGTTAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023068.3-2222s21c1
Sequence:CCGGACTTCTCCTGGTTCCGAAATGCTCGAGCATTTCGGAACCAGGAGAAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-4425s1c1
Sequence:CCGGCAACTCCACCTTTGCATGGTTCTCGAGAACCATGCAAAGGTGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-4253s1c1
Sequence:CCGGCAGGTGATGACACCTATGTTTCTCGAGAAACATAGGTGTCATCACCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-2842s1c1
Sequence:CCGGGCAGCCATAACTTTGACACAACTCGAGTTGTGTCAAAGTTATGGCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023068.2-813s1c1
Sequence:CCGGCAGTTCCATTAAGTGGCTCAACTCGAGTTGAGCCACTTAATGGAACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011426
SIGLEC1 MISSION shRNA Bacterial Glycerol Stock
sialic acid binding Ig-like lectin 1, sialoadhesin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011426.1-2759s1c1
Sequence:CCGGCGCAGCCTCTTTCAATGCTAACTCGAGTTAGCATTGAAAGAGGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011426.1-2096s1c1
Sequence:CCGGGCGCCTAGAAATCCGAGACTTCTCGAGAAGTCTCGGATTTCTAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011426.1-4875s1c1
Sequence:CCGGCGAAATGCTCTTCGACTACAACTCGAGTTGTAGTCGAAGAGCATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011426.1-4884s1c1
Sequence:CCGGCTTCGACTACAAGTGCAAGATCTCGAGATCTTGCACTTGTAGTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011426.1-6350s1c1
Sequence:CCGGCGCTAGAAACTGGTCACATAACTCGAGTTATGTGACCAGTTTCTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011426
SIGLEC1 MISSION shRNA shRNA Plasmid DNA
sialic acid binding Ig-like lectin 1, sialoadhesin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011426.1-2759s1c1
Sequence:CCGGCGCAGCCTCTTTCAATGCTAACTCGAGTTAGCATTGAAAGAGGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011426.1-2096s1c1
Sequence:CCGGGCGCCTAGAAATCCGAGACTTCTCGAGAAGTCTCGGATTTCTAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011426.1-4875s1c1
Sequence:CCGGCGAAATGCTCTTCGACTACAACTCGAGTTGTAGTCGAAGAGCATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011426.1-4884s1c1
Sequence:CCGGCTTCGACTACAAGTGCAAGATCTCGAGATCTTGCACTTGTAGTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011426.1-6350s1c1
Sequence:CCGGCGCTAGAAACTGGTCACATAACTCGAGTTATGTGACCAGTTTCTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011426
SIGLEC1 MISSION shRNA Lentiviral Transduction Particles
sialic acid binding Ig-like lectin 1, sialoadhesin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011426.1-2759s1c1
Sequence:CCGGCGCAGCCTCTTTCAATGCTAACTCGAGTTAGCATTGAAAGAGGCTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011426.1-2096s1c1
Sequence:CCGGGCGCCTAGAAATCCGAGACTTCTCGAGAAGTCTCGGATTTCTAGGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011426.1-4875s1c1
Sequence:CCGGCGAAATGCTCTTCGACTACAACTCGAGTTGTAGTCGAAGAGCATTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011426.1-4884s1c1
Sequence:CCGGCTTCGACTACAAGTGCAAGATCTCGAGATCTTGCACTTGTAGTCGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011426.1-6350s1c1
Sequence:CCGGCGCTAGAAACTGGTCACATAACTCGAGTTATGTGACCAGTTTCTAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)