EMAIL THIS PAGE TO A FRIEND

SIGLEC6

sialic acid binding Ig-like lectin 6

59 Gene Product Result for
Synonyms: CD327 CD33L CD33L1 CD33L2 CDW327 OBBP1
Species: Human SIGLEC6(946)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001245 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001245 Rosetta Predictions human pricing
NM_198845 Rosetta Predictions human pricing
NM_198846 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203174 predicted 388
2 SASI_Hs01_00203175 predicted 517
3 SASI_Hs01_00203176 predicted 494
4 SASI_Hs01_00203177 predicted 543
5 SASI_Hs01_00203178 predicted 523
6 SASI_Hs01_00203179 predicted 510
7 SASI_Hs01_00203180 predicted 534
8 SASI_Hs01_00203181 predicted 507
9 SASI_Hs01_00203182 predicted 547
10 SASI_Hs01_00203183 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219098 predicted 392
2 SASI_Hs01_00219099 predicted 523
3 SASI_Hs01_00219100 predicted 500
4 SASI_Hs01_00219101 predicted 540
5 SASI_Hs01_00219102 predicted 521
6 SASI_Hs01_00219103 predicted 509
7 SASI_Hs01_00219104 predicted 534
8 SASI_Hs01_00219105 predicted 505
9 SASI_Hs01_00219106 predicted 551
10 SASI_Hs01_00219107 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027756 predicted 384
2 SASI_Hs01_00027757 predicted 522
3 SASI_Hs01_00027758 predicted 495
4 SASI_Hs01_00027759 predicted 543
5 SASI_Hs01_00027760 predicted 524
6 SASI_Hs01_00027761 predicted 510
7 SASI_Hs01_00027762 predicted 534
8 SASI_Hs01_00027763 predicted 505
9 SASI_Hs01_00027764 predicted 546
10 SASI_Hs01_00027765 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001245
SIGLEC6 MISSION shRNA Bacterial Glycerol Stock
sialic acid binding Ig-like lectin 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001245.2-2541s1c1
Sequence:CCGGGCCCAGAAACTATAATAACATCTCGAGATGTTATTATAGTTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001245.2-334s1c1
Sequence:CCGGCCAGCCTCGTACTATGGTTATCTCGAGATAACCATAGTACGAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001245.2-1245s1c1
Sequence:CCGGCCTCTGTGTTTGCTTCATCTTCTCGAGAAGATGAAGCAAACACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001245.2-537s1c1
Sequence:CCGGCAAATGGATGAAATACGGTTACTCGAGTAACCGTATTTCATCCATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001245.2-1488s1c1
Sequence:CCGGCGACACTGAGTACTCAGAAATCTCGAGATTTCTGAGTACTCAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001245
SIGLEC6 MISSION shRNA shRNA Plasmid DNA
sialic acid binding Ig-like lectin 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001245.2-2541s1c1
Sequence:CCGGGCCCAGAAACTATAATAACATCTCGAGATGTTATTATAGTTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001245.2-334s1c1
Sequence:CCGGCCAGCCTCGTACTATGGTTATCTCGAGATAACCATAGTACGAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001245.2-1245s1c1
Sequence:CCGGCCTCTGTGTTTGCTTCATCTTCTCGAGAAGATGAAGCAAACACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001245.2-537s1c1
Sequence:CCGGCAAATGGATGAAATACGGTTACTCGAGTAACCGTATTTCATCCATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001245.2-1488s1c1
Sequence:CCGGCGACACTGAGTACTCAGAAATCTCGAGATTTCTGAGTACTCAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001245
SIGLEC6 MISSION shRNA Lentiviral Transduction Particles
sialic acid binding Ig-like lectin 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001245.2-2541s1c1
Sequence:CCGGGCCCAGAAACTATAATAACATCTCGAGATGTTATTATAGTTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001245.2-334s1c1
Sequence:CCGGCCAGCCTCGTACTATGGTTATCTCGAGATAACCATAGTACGAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001245.2-1245s1c1
Sequence:CCGGCCTCTGTGTTTGCTTCATCTTCTCGAGAAGATGAAGCAAACACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001245.2-537s1c1
Sequence:CCGGCAAATGGATGAAATACGGTTACTCGAGTAACCGTATTTCATCCATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001245.2-1488s1c1
Sequence:CCGGCGACACTGAGTACTCAGAAATCTCGAGATTTCTGAGTACTCAGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)