EMAIL THIS PAGE TO A FRIEND

SIGMAR1

sigma non-opioid intracellular receptor 1

157 Gene Product Result for
Synonyms: ALS16 OPRS1 SIG-1R SR-BP SR-BP1 SRBP hSigmaR1 sigma1R
Gene ID:
Human(10280) Summary: This gene encodes a receptor protein that interacts with a variety of psychotomimetic drugs, including cocaine and amphetamines. The receptor is believed to play an important role in the cellular functions of various tissues associated with the endocrine, immune, and nervous systems. As indicated by its previous name, opioid receptor sigma 1 (OPRS1), the product of this gene was erroneously thought to function as an opioid receptor; it is now thought to be a non-opioid receptor. Alternative splicing of this gene results in transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2008]
Mouse(18391) sigma non-opioid intracellular receptor 1
Rat(29336) sigma non-opioid intracellular receptor 1
Zebrafish(393952) sigma non-opioid intracellular receptor 1
dog(481587) sigma non-opioid intracellular receptor 1
domestic cat(101084912) sigma non-opioid intracellular receptor 1
chicken(100859748) sigma non-opioid intracellular receptor 1
cow(538903) sigma non-opioid intracellular receptor 1
sheep(101116710) sigma non-opioid intracellular receptor 1
domestic guinea pig(100135589) sigma non-opioid intracellular receptor 1
naked mole-rat(101707150) sigma non-opioid intracellular receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Ligand

Product # Description Species Add to Cart
 
U106 (−)-cis-(1S,2R)-U-50488 tartrate solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011014 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011014 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011014 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005866 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU090551 MISSION® esiRNA esiRNA targeting mouse Sigmar1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005866 Rosetta Predictions human pricing
NM_147157 Rosetta Predictions human pricing
NM_147158 Rosetta Predictions human pricing
NM_030996 Rosetta Predictions rat pricing
NM_011014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076389 predicted 1042
2 SASI_Hs01_00076391 predicted 1013
3 SASI_Hs01_00076392 predicted 872
4 SASI_Hs02_00340431 predicted 875
5 SASI_Hs01_00076395 predicted 1033
6 SASI_Hs01_00076396 predicted 968
7 SASI_Hs02_00340432 predicted 195
8 SASI_Hs02_00340433 predicted 827
9 SASI_Hs01_00076397 predicted 1052
10 SASI_Hs02_00340434 predicted 1023
11 SASI_Hs01_00076390 predicted 891
12 SASI_Hs01_00076393 predicted 804
13 SASI_Hs01_00076394 predicted 873
14 SASI_Hs01_00076398 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189688 predicted 954
2 SASI_Hs01_00189690 predicted 920
3 SASI_Hs01_00189691 predicted 777
4 SASI_Hs02_00365489 predicted 788
5 SASI_Hs01_00189694 predicted 932
6 SASI_Hs01_00189695 predicted 872
7 SASI_Hs02_00365490 predicted 200
8 SASI_Hs02_00365491 predicted 738
9 SASI_Hs01_00189696 predicted 956
10 SASI_Hs02_00365492 predicted 933
11 SASI_Hs01_00189689 predicted 790
12 SASI_Hs01_00189692 predicted 719
13 SASI_Hs01_00189693 predicted 785
14 SASI_Hs01_00189697 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125424 predicted 946
2 SASI_Hs01_00125425 predicted 784
3 SASI_Hs01_00125426 predicted 903
4 SASI_Hs01_00125427 predicted 774
5 SASI_Hs01_00125428 predicted 704
6 SASI_Hs01_00125429 predicted 772
7 SASI_Hs01_00125430 predicted 930
8 SASI_Hs01_00125431 predicted 863
9 SASI_Hs01_00125432 predicted 943
10 SASI_Hs01_00125433 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115957 predicted 399
2 SASI_Rn01_00115958 predicted 889
3 SASI_Rn01_00115959 predicted 976
4 SASI_Rn01_00115960 predicted 380
5 SASI_Rn01_00115961 predicted 808
6 SASI_Rn01_00115962 predicted 797
7 SASI_Rn01_00115963 predicted 1104
8 SASI_Rn01_00115964 predicted 678
9 SASI_Rn01_00115965 predicted 410
10 SASI_Rn01_00115966 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031003 predicted 818
2 SASI_Mm01_00031004 predicted 416
3 SASI_Mm01_00031005 predicted 785
4 SASI_Mm01_00031009 predicted 922
5 SASI_Mm02_00319734 predicted 919
6 SASI_Mm01_00031006 predicted 848
7 SASI_Mm01_00031007 predicted 407
8 SASI_Mm01_00031008 predicted 551
9 SASI_Mm01_00031010 predicted 406
10 SASI_Mm01_00031011 predicted 464
11 SASI_Mm01_00031012 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011014
VALIDATED
SIGMAR1 MISSION shRNA Bacterial Glycerol Stock
sigma non-opioid intracellular receptor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011014.2-1138s21c1
Sequence:CCGGCCTGTAGTAATCTCTGGTGAACTCGAGTTCACCAGAGATTACTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011014.1-97s1c1
Sequence:CCGGCACCCTGATTCTGACTATTATCTCGAGATAATAGTCAGAATCAGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011014.1-1254s1c1
Sequence:CCGGCCAATCCTTTCCTATCCATATCTCGAGATATGGATAGGAAAGGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011014.1-1139s1c1
Sequence:CCGGCCTGTAGTAATCTCTGGTGAACTCGAGTTCACCAGAGATTACTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011014.2-97s21c1
Sequence:CCGGCACCCTGATTCTGACTATTATCTCGAGATAATAGTCAGAATCAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011014.2-109s21c1
Sequence:CCGGGACTATTATCGCAGTGCTGATCTCGAGATCAGCACTGCGATAATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011014.1-827s1c1
Sequence:CCGGGCGTATACCATGCAGATATTACTCGAGTAATATCTGCATGGTATACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011014.1-109s1c1
Sequence:CCGGGACTATTATCGCAGTGCTGATCTCGAGATCAGCACTGCGATAATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011014.2-827s21c1
Sequence:CCGGGCGTATACCATGCAGATATTACTCGAGTAATATCTGCATGGTATACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011014
VALIDATED
SIGMAR1 MISSION shRNA shRNA Plasmid DNA
sigma non-opioid intracellular receptor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011014.2-1138s21c1
Sequence:CCGGCCTGTAGTAATCTCTGGTGAACTCGAGTTCACCAGAGATTACTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011014.1-97s1c1
Sequence:CCGGCACCCTGATTCTGACTATTATCTCGAGATAATAGTCAGAATCAGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011014.1-1254s1c1
Sequence:CCGGCCAATCCTTTCCTATCCATATCTCGAGATATGGATAGGAAAGGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011014.1-1139s1c1
Sequence:CCGGCCTGTAGTAATCTCTGGTGAACTCGAGTTCACCAGAGATTACTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011014.2-97s21c1
Sequence:CCGGCACCCTGATTCTGACTATTATCTCGAGATAATAGTCAGAATCAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011014.2-109s21c1
Sequence:CCGGGACTATTATCGCAGTGCTGATCTCGAGATCAGCACTGCGATAATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011014.1-827s1c1
Sequence:CCGGGCGTATACCATGCAGATATTACTCGAGTAATATCTGCATGGTATACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011014.1-109s1c1
Sequence:CCGGGACTATTATCGCAGTGCTGATCTCGAGATCAGCACTGCGATAATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011014.2-827s21c1
Sequence:CCGGGCGTATACCATGCAGATATTACTCGAGTAATATCTGCATGGTATACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011014
VALIDATED
SIGMAR1 MISSION shRNA Lentiviral Transduction Particles
sigma non-opioid intracellular receptor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011014.2-1138s21c1
Sequence:CCGGCCTGTAGTAATCTCTGGTGAACTCGAGTTCACCAGAGATTACTACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011014.1-97s1c1
Sequence:CCGGCACCCTGATTCTGACTATTATCTCGAGATAATAGTCAGAATCAGGGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011014.1-1254s1c1
Sequence:CCGGCCAATCCTTTCCTATCCATATCTCGAGATATGGATAGGAAAGGATTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011014.1-1139s1c1
Sequence:CCGGCCTGTAGTAATCTCTGGTGAACTCGAGTTCACCAGAGATTACTACAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011014.2-97s21c1
Sequence:CCGGCACCCTGATTCTGACTATTATCTCGAGATAATAGTCAGAATCAGGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011014.2-109s21c1
Sequence:CCGGGACTATTATCGCAGTGCTGATCTCGAGATCAGCACTGCGATAATAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011014.1-827s1c1
Sequence:CCGGGCGTATACCATGCAGATATTACTCGAGTAATATCTGCATGGTATACGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011014.1-109s1c1
Sequence:CCGGGACTATTATCGCAGTGCTGATCTCGAGATCAGCACTGCGATAATAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011014.2-827s21c1
Sequence:CCGGGCGTATACCATGCAGATATTACTCGAGTAATATCTGCATGGTATACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005866
VALIDATED
SIGMAR1 MISSION shRNA Bacterial Glycerol Stock
sigma non-opioid intracellular receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005866.2-657s21c1
Sequence:CCGGGACTTCCTCACCCTCTTCTATCTCGAGATAGAAGAGGGTGAGGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005866.2-667s1c1
Sequence:CCGGCCCTCTTCTATACTCTTCGCTCTCGAGAGCGAAGAGTATAGAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005866.2-569s1c1
Sequence:CCGGGCCAAACACATGGATGGTGGACTCGAGTCCACCATCCATGTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005866.2-657s1c1
Sequence:CCGGGACTTCCTCACCCTCTTCTATCTCGAGATAGAAGAGGGTGAGGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005866.2-239s1c1
Sequence:CCGGGCTGGCCTTCTCTCGTCTGATCTCGAGATCAGACGAGAGAAGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005866.2-440s21c1
Sequence:CCGGTGAGATCTCGGATACCATCATCTCGAGATGATGGTATCCGAGATCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005866.2-1160s21c1
Sequence:CCGGCCTCAACCCAGCAGCAATTTGCTCGAGCAAATTGCTGCTGGGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005866.2-239s21c1
Sequence:CCGGGCTGGCCTTCTCTCGTCTGATCTCGAGATCAGACGAGAGAAGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005866
VALIDATED
SIGMAR1 MISSION shRNA shRNA Plasmid DNA
sigma non-opioid intracellular receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005866.2-657s21c1
Sequence:CCGGGACTTCCTCACCCTCTTCTATCTCGAGATAGAAGAGGGTGAGGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005866.2-667s1c1
Sequence:CCGGCCCTCTTCTATACTCTTCGCTCTCGAGAGCGAAGAGTATAGAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005866.2-569s1c1
Sequence:CCGGGCCAAACACATGGATGGTGGACTCGAGTCCACCATCCATGTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005866.2-657s1c1
Sequence:CCGGGACTTCCTCACCCTCTTCTATCTCGAGATAGAAGAGGGTGAGGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005866.2-239s1c1
Sequence:CCGGGCTGGCCTTCTCTCGTCTGATCTCGAGATCAGACGAGAGAAGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005866.2-440s21c1
Sequence:CCGGTGAGATCTCGGATACCATCATCTCGAGATGATGGTATCCGAGATCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005866.2-1160s21c1
Sequence:CCGGCCTCAACCCAGCAGCAATTTGCTCGAGCAAATTGCTGCTGGGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005866.2-239s21c1
Sequence:CCGGGCTGGCCTTCTCTCGTCTGATCTCGAGATCAGACGAGAGAAGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005866
VALIDATED
SIGMAR1 MISSION shRNA Lentiviral Transduction Particles
sigma non-opioid intracellular receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005866.2-657s21c1
Sequence:CCGGGACTTCCTCACCCTCTTCTATCTCGAGATAGAAGAGGGTGAGGAAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005866.2-667s1c1
Sequence:CCGGCCCTCTTCTATACTCTTCGCTCTCGAGAGCGAAGAGTATAGAAGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005866.2-569s1c1
Sequence:CCGGGCCAAACACATGGATGGTGGACTCGAGTCCACCATCCATGTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005866.2-657s1c1
Sequence:CCGGGACTTCCTCACCCTCTTCTATCTCGAGATAGAAGAGGGTGAGGAAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005866.2-239s1c1
Sequence:CCGGGCTGGCCTTCTCTCGTCTGATCTCGAGATCAGACGAGAGAAGGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005866.2-440s21c1
Sequence:CCGGTGAGATCTCGGATACCATCATCTCGAGATGATGGTATCCGAGATCTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005866.2-1160s21c1
Sequence:CCGGCCTCAACCCAGCAGCAATTTGCTCGAGCAAATTGCTGCTGGGTTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005866.2-239s21c1
Sequence:CCGGGCTGGCCTTCTCTCGTCTGATCTCGAGATCAGACGAGAGAAGGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)