EMAIL THIS PAGE TO A FRIEND

SIK1

salt-inducible kinase 1

87 Gene Product Result for
Synonyms: MSK SIK SNF1LK
UniProtKB ID: P57059, A6NC84, Q5R2V5, Q6ZNL8, Q86YJ2
Gene ID:
Mouse(17691) salt inducible kinase 1
Rat(59329) salt-inducible kinase 1
naked mole-rat(101702040) salt-inducible kinase 1
domestic guinea pig(100724260) salt-inducible kinase 1
cow(100337254) salt-inducible kinase 1
cow(529156) salt-inducible kinase 1
sheep(101122497) salt-inducible kinase 1
Thale Cress(843253) putative serine/threonine kinase
dog(487787) salt-inducible kinase 1
domestic cat(101092782) salt-inducible kinase 1
Horse(100057456) salt-inducible kinase 1
chicken(395417) salt-inducible kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173354 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138711 MISSION® esiRNA esiRNA human SIK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173354 Rosetta Predictions human pricing
NM_021693 Rosetta Predictions rat pricing
NM_010831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239672 predicted 497
2 SASI_Hs01_00239673 predicted 362
3 SASI_Hs01_00239674 predicted 371
4 SASI_Hs01_00239675 predicted 485
5 SASI_Hs01_00239677 predicted 1257
6 SASI_Hs01_00239678 predicted 302
7 SASI_Hs01_00239680 predicted 309
8 SASI_Hs01_00239681 predicted 395
9 SASI_Hs02_00368185 predicted 360
10 SASI_Hs02_00368186 predicted 631
11 SASI_Hs01_00239676 predicted 636
12 SASI_Hs01_00239679 predicted 1917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053038 predicted 1485
2 SASI_Rn01_00053039 predicted 1061
3 SASI_Rn01_00053040 predicted 548
4 SASI_Rn01_00053041 predicted 245
5 SASI_Rn01_00053042 predicted 319
6 SASI_Rn01_00053043 predicted 806
7 SASI_Rn01_00053044 predicted 1043
8 SASI_Rn01_00053045 predicted 2056
9 SASI_Rn01_00053046 predicted 1054
10 SASI_Rn02_00262729 predicted 1482
11 SASI_Rn01_00053047 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112870 predicted 1126
2 SASI_Mm01_00112871 predicted 1371
3 SASI_Mm01_00112872 predicted 302
4 SASI_Mm01_00112873 predicted 405
5 SASI_Mm01_00112874 predicted 417
6 SASI_Mm01_00112875 predicted 427
7 SASI_Mm01_00112876 predicted 617
8 SASI_Mm02_00319458 predicted 427
9 SASI_Mm01_00112878 predicted 382
10 SASI_Mm02_00319459 predicted 2193
11 SASI_Mm01_00112877 predicted 453
12 SASI_Mm01_00112879 predicted 1554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173354
VALIDATED
SIK1 MISSION shRNA Bacterial Glycerol Stock
salt-inducible kinase 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173354.3-350s21c1
Sequence:CCGGGTTCAGCTGATGAAGCTTCTGCTCGAGCAGAAGCTTCATCAGCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173354.3-310s21c1
Sequence:CCGGACGATTAGATTCAAGCAATTTCTCGAGAAATTGCTTGAATCTAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.2-511s1c1
Sequence:CCGGGCGGAAGAAGTTCTGGCAAATCTCGAGATTTGCCAGAACTTCTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173354.2-2888s1c1
Sequence:CCGGGCGCGTGCATTGATTACTATCCTCGAGGATAGTAATCAATGCACGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_173354.2-1647s1c1
Sequence:CCGGCTGACAGTTGTCTGACCTTCTCTCGAGAGAAGGTCAGACAACTGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.2-605s1c1
Sequence:CCGGGATGGCAACATGGACATCAAGCTCGAGCTTGATGTCCATGTTGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_173354.2-356s1c1
Sequence:CCGGGTTCAGCTGATGAAGCTTCTGCTCGAGCAGAAGCTTCATCAGCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173354.2-3952s1c1
Sequence:CCGGGCCAAAGATTGACCCAGTTACCTCGAGGTAACTGGGTCAATCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173354.3-2882s21c1
Sequence:CCGGGCGCGTGCATTGATTACTATCCTCGAGGATAGTAATCAATGCACGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.x-343s1c1
Sequence:CCGGCCATCCACACATCATAAAGCTCTCGAGAGCTTTATGATGTGTGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173354.3-1641s21c1
Sequence:CCGGCTGACAGTTGTCTGACCTTCTCTCGAGAGAAGGTCAGACAACTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173354.3-3946s21c1
Sequence:CCGGGCCAAAGATTGACCCAGTTACCTCGAGGTAACTGGGTCAATCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173354.x-4597s1c1
Sequence:CCGGGAGAAATGTATGCCAAATGATCTCGAGATCATTTGGCATACATTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.x-344s1c1
Sequence:CCGGCATCCACACATCATAAAGCTTCTCGAGAAGCTTTATGATGTGTGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.x-1104s1c1
Sequence:CCGGCCATTTATTACCTCCTCCTTGCTCGAGCAAGGAGGAGGTAATAAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.x-1105s1c1
Sequence:CCGGCATTTATTACCTCCTCCTTGACTCGAGTCAAGGAGGAGGTAATAAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173354
VALIDATED
SIK1 MISSION shRNA shRNA Plasmid DNA
salt-inducible kinase 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173354.3-350s21c1
Sequence:CCGGGTTCAGCTGATGAAGCTTCTGCTCGAGCAGAAGCTTCATCAGCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173354.3-310s21c1
Sequence:CCGGACGATTAGATTCAAGCAATTTCTCGAGAAATTGCTTGAATCTAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.2-511s1c1
Sequence:CCGGGCGGAAGAAGTTCTGGCAAATCTCGAGATTTGCCAGAACTTCTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173354.2-2888s1c1
Sequence:CCGGGCGCGTGCATTGATTACTATCCTCGAGGATAGTAATCAATGCACGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_173354.2-1647s1c1
Sequence:CCGGCTGACAGTTGTCTGACCTTCTCTCGAGAGAAGGTCAGACAACTGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.2-605s1c1
Sequence:CCGGGATGGCAACATGGACATCAAGCTCGAGCTTGATGTCCATGTTGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_173354.2-356s1c1
Sequence:CCGGGTTCAGCTGATGAAGCTTCTGCTCGAGCAGAAGCTTCATCAGCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173354.2-3952s1c1
Sequence:CCGGGCCAAAGATTGACCCAGTTACCTCGAGGTAACTGGGTCAATCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173354.3-2882s21c1
Sequence:CCGGGCGCGTGCATTGATTACTATCCTCGAGGATAGTAATCAATGCACGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.x-343s1c1
Sequence:CCGGCCATCCACACATCATAAAGCTCTCGAGAGCTTTATGATGTGTGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173354.3-1641s21c1
Sequence:CCGGCTGACAGTTGTCTGACCTTCTCTCGAGAGAAGGTCAGACAACTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173354.3-3946s21c1
Sequence:CCGGGCCAAAGATTGACCCAGTTACCTCGAGGTAACTGGGTCAATCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173354.x-4597s1c1
Sequence:CCGGGAGAAATGTATGCCAAATGATCTCGAGATCATTTGGCATACATTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.x-344s1c1
Sequence:CCGGCATCCACACATCATAAAGCTTCTCGAGAAGCTTTATGATGTGTGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.x-1104s1c1
Sequence:CCGGCCATTTATTACCTCCTCCTTGCTCGAGCAAGGAGGAGGTAATAAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.x-1105s1c1
Sequence:CCGGCATTTATTACCTCCTCCTTGACTCGAGTCAAGGAGGAGGTAATAAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173354
VALIDATED
SIK1 MISSION shRNA Lentiviral Transduction Particles
salt-inducible kinase 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173354.3-350s21c1
Sequence:CCGGGTTCAGCTGATGAAGCTTCTGCTCGAGCAGAAGCTTCATCAGCTGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173354.3-310s21c1
Sequence:CCGGACGATTAGATTCAAGCAATTTCTCGAGAAATTGCTTGAATCTAATCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.2-511s1c1
Sequence:CCGGGCGGAAGAAGTTCTGGCAAATCTCGAGATTTGCCAGAACTTCTTCCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173354.2-2888s1c1
Sequence:CCGGGCGCGTGCATTGATTACTATCCTCGAGGATAGTAATCAATGCACGCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_173354.2-1647s1c1
Sequence:CCGGCTGACAGTTGTCTGACCTTCTCTCGAGAGAAGGTCAGACAACTGTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.2-605s1c1
Sequence:CCGGGATGGCAACATGGACATCAAGCTCGAGCTTGATGTCCATGTTGCCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_173354.2-356s1c1
Sequence:CCGGGTTCAGCTGATGAAGCTTCTGCTCGAGCAGAAGCTTCATCAGCTGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173354.2-3952s1c1
Sequence:CCGGGCCAAAGATTGACCCAGTTACCTCGAGGTAACTGGGTCAATCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173354.3-2882s21c1
Sequence:CCGGGCGCGTGCATTGATTACTATCCTCGAGGATAGTAATCAATGCACGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.x-343s1c1
Sequence:CCGGCCATCCACACATCATAAAGCTCTCGAGAGCTTTATGATGTGTGGATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173354.3-1641s21c1
Sequence:CCGGCTGACAGTTGTCTGACCTTCTCTCGAGAGAAGGTCAGACAACTGTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173354.3-3946s21c1
Sequence:CCGGGCCAAAGATTGACCCAGTTACCTCGAGGTAACTGGGTCAATCTTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173354.x-4597s1c1
Sequence:CCGGGAGAAATGTATGCCAAATGATCTCGAGATCATTTGGCATACATTTCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.x-344s1c1
Sequence:CCGGCATCCACACATCATAAAGCTTCTCGAGAAGCTTTATGATGTGTGGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.x-1104s1c1
Sequence:CCGGCCATTTATTACCTCCTCCTTGCTCGAGCAAGGAGGAGGTAATAAATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173354.x-1105s1c1
Sequence:CCGGCATTTATTACCTCCTCCTTGACTCGAGTCAAGGAGGAGGTAATAAATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010831
VALIDATED
SIK1 MISSION shRNA Bacterial Glycerol Stock
salt-inducible kinase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010831.2-386s21c1
Sequence:CCGGCCCAAATATCATCAAGCTTTACTCGAGTAAAGCTTGATGATATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010831.2-431s21c1
Sequence:CCGGGCTCTACATTGTCACAGAATTCTCGAGAATTCTGTGACAATGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010831.2-620s21c1
Sequence:CCGGGGATATCAAGCTAGCAGATTTCTCGAGAAATCTGCTAGCTTGATATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010831.2-2871s21c1
Sequence:CCGGTGTAGTGGTTGGCGTTGTTTCCTCGAGGAAACAACGCCAACCACTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010831.1-1370s1c1
Sequence:CCGGGCTCACTTCAGCCCTTATTATCTCGAGATAATAAGGGCTGAAGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010831.1-310s1c1
Sequence:CCGGACACGGTTAGATTCTAGCAATCTCGAGATTGCTAGAATCTAACCGTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010831.1-1132s1c1
Sequence:CCGGGCCGCCATTTACTACCTCCTACTCGAGTAGGAGGTAGTAAATGGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010831.1-1933s1c1
Sequence:CCGGCTGGGACTGAACAAGATCAAACTCGAGTTTGATCTTGTTCAGTCCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010831.1-423s1c1
Sequence:CCGGGCTCTACATTGTCACAGAATTCTCGAGAATTCTGTGACAATGTAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010831.2-1378s21c1
Sequence:CCGGGCTCACTTCAGCCCTTATTATCTCGAGATAATAAGGGCTGAAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010831
VALIDATED
SIK1 MISSION shRNA shRNA Plasmid DNA
salt-inducible kinase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010831.2-386s21c1
Sequence:CCGGCCCAAATATCATCAAGCTTTACTCGAGTAAAGCTTGATGATATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010831.2-431s21c1
Sequence:CCGGGCTCTACATTGTCACAGAATTCTCGAGAATTCTGTGACAATGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010831.2-620s21c1
Sequence:CCGGGGATATCAAGCTAGCAGATTTCTCGAGAAATCTGCTAGCTTGATATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010831.2-2871s21c1
Sequence:CCGGTGTAGTGGTTGGCGTTGTTTCCTCGAGGAAACAACGCCAACCACTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010831.1-1370s1c1
Sequence:CCGGGCTCACTTCAGCCCTTATTATCTCGAGATAATAAGGGCTGAAGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010831.1-310s1c1
Sequence:CCGGACACGGTTAGATTCTAGCAATCTCGAGATTGCTAGAATCTAACCGTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010831.1-1132s1c1
Sequence:CCGGGCCGCCATTTACTACCTCCTACTCGAGTAGGAGGTAGTAAATGGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010831.1-1933s1c1
Sequence:CCGGCTGGGACTGAACAAGATCAAACTCGAGTTTGATCTTGTTCAGTCCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010831.1-423s1c1
Sequence:CCGGGCTCTACATTGTCACAGAATTCTCGAGAATTCTGTGACAATGTAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010831.2-1378s21c1
Sequence:CCGGGCTCACTTCAGCCCTTATTATCTCGAGATAATAAGGGCTGAAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010831
VALIDATED
SIK1 MISSION shRNA Lentiviral Transduction Particles
salt-inducible kinase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010831.2-386s21c1
Sequence:CCGGCCCAAATATCATCAAGCTTTACTCGAGTAAAGCTTGATGATATTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010831.2-431s21c1
Sequence:CCGGGCTCTACATTGTCACAGAATTCTCGAGAATTCTGTGACAATGTAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010831.2-620s21c1
Sequence:CCGGGGATATCAAGCTAGCAGATTTCTCGAGAAATCTGCTAGCTTGATATCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010831.2-2871s21c1
Sequence:CCGGTGTAGTGGTTGGCGTTGTTTCCTCGAGGAAACAACGCCAACCACTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010831.1-1370s1c1
Sequence:CCGGGCTCACTTCAGCCCTTATTATCTCGAGATAATAAGGGCTGAAGTGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010831.1-310s1c1
Sequence:CCGGACACGGTTAGATTCTAGCAATCTCGAGATTGCTAGAATCTAACCGTGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010831.1-1132s1c1
Sequence:CCGGGCCGCCATTTACTACCTCCTACTCGAGTAGGAGGTAGTAAATGGCGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010831.1-1933s1c1
Sequence:CCGGCTGGGACTGAACAAGATCAAACTCGAGTTTGATCTTGTTCAGTCCCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010831.1-423s1c1
Sequence:CCGGGCTCTACATTGTCACAGAATTCTCGAGAATTCTGTGACAATGTAGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010831.2-1378s21c1
Sequence:CCGGGCTCACTTCAGCCCTTATTATCTCGAGATAATAAGGGCTGAAGTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)