EMAIL THIS PAGE TO A FRIEND

SIL1

SIL1 nucleotide exchange factor

60 Gene Product Result for
Synonyms: BAP MSS ULG5
UniProtKB ID: Q9H173, D3DQC2, Q8N2L3
Gene ID:
Human(64374) Summary: This gene encodes a resident endoplasmic reticulum (ER), N-linked glycoprotein with an N-terminal ER targeting sequence, 2 putative N-glycosylation sites, and a C-terminal ER retention signal. This protein functions as a nucleotide exchange factor for another unfolded protein response protein. Mutations in this gene have been associated with Marinesco-Sjogren syndrome. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
Mouse(81500) endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)
Rat(291673) SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)
chicken(416185) SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)
dog(474699) SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)
domestic cat(101089979) SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)
Horse(100072543) SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)
domestic guinea pig(100722382) SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)
naked mole-rat(101716450) SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)
Domestic Rabbit(100347643) SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)
cow(520650) SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)
sheep(101112978) SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022464 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037633 Rosetta Predictions human pricing
NM_022464 Rosetta Predictions human pricing
NM_199376 Rosetta Predictions rat pricing
NM_030749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196801 predicted 1224
2 SASI_Hs01_00196802 predicted 883
3 SASI_Hs01_00196803 predicted 523
4 SASI_Hs01_00196804 predicted 569
5 SASI_Hs01_00196805 predicted 759
6 SASI_Hs01_00196807 predicted 869
7 SASI_Hs01_00196808 predicted 713
8 SASI_Hs01_00196809 predicted 759
9 SASI_Hs02_00308335 predicted 519
10 SASI_Hs02_00308336 predicted 744
11 SASI_Hs01_00196806 predicted 430
12 SASI_Hs01_00196810 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140157 predicted 1131
2 SASI_Hs01_00140158 predicted 794
3 SASI_Hs01_00140159 predicted 435
4 SASI_Hs01_00140160 predicted 485
5 SASI_Hs01_00140161 predicted 675
6 SASI_Hs01_00140163 predicted 775
7 SASI_Hs01_00140164 predicted 620
8 SASI_Hs01_00140165 predicted 675
9 SASI_Hs02_00355734 predicted 433
10 SASI_Hs02_00355735 predicted 655
11 SASI_Hs01_00140162 predicted 336
12 SASI_Hs01_00140166 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051298 predicted 699
2 SASI_Rn01_00051299 predicted 692
3 SASI_Rn01_00051300 predicted 633
4 SASI_Rn02_00270184 predicted 955
5 SASI_Rn01_00051301 predicted 397
6 SASI_Rn01_00051302 predicted 515
7 SASI_Rn01_00051303 predicted 593
8 SASI_Rn01_00051304 predicted 1063
9 SASI_Rn01_00051306 predicted 395
10 SASI_Rn02_00270185 predicted 408
11 SASI_Rn01_00051305 predicted 715
12 SASI_Rn01_00051307 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155951 predicted 1356
2 SASI_Mm01_00155952 predicted 283
3 SASI_Mm01_00155954 predicted 1050
4 SASI_Mm01_00155956 predicted 387
5 SASI_Mm01_00155957 predicted 642
6 SASI_Mm02_00336955 predicted 695
7 SASI_Mm01_00155958 predicted 585
8 SASI_Mm01_00155959 predicted 521
9 SASI_Mm01_00155960 predicted 711
10 SASI_Mm02_00336956 predicted 721
11 SASI_Mm01_00155953 predicted 698
12 SASI_Mm01_00155955 predicted 1122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030749
VALIDATED
SIL1 MISSION shRNA Bacterial Glycerol Stock
SIL1 nucleotide exchange factor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030749.1-646s21c1
Sequence:CCGGGATTATGGTTCGGCTGATAAACTCGAGTTTATCAGCCGAACCATAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030749.1-490s21c1
Sequence:CCGGCAAGAGTGCGCTGGCCAAATTCTCGAGAATTTGGCCAGCGCACTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030749.1-226s1c1
Sequence:CCGGCCACCAGGAATCAGATACAAACTCGAGTTTGTATCTGATTCCTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030749.1-776s21c1
Sequence:CCGGGGCCTTCAAGTGGTGATTAATCTCGAGATTAATCACCACTTGAAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030749.1-699s21c1
Sequence:CCGGAGAAGGTTGCTGCGCTCTTTGCTCGAGCAAAGAGCGCAGCAACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030749.1-175s21c1
Sequence:CCGGCAGCTGTCAGAACTCAAATAACTCGAGTTATTTGAGTTCTGACAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030749.1-719s1c1
Sequence:CCGGGATCTTGAGTACTATGTCCATCTCGAGATGGACATAGTACTCAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030749.1-643s1c1
Sequence:CCGGGCAGATTATGGTTCGGCTGATCTCGAGATCAGCCGAACCATAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030749
VALIDATED
SIL1 MISSION shRNA shRNA Plasmid DNA
SIL1 nucleotide exchange factor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030749.1-646s21c1
Sequence:CCGGGATTATGGTTCGGCTGATAAACTCGAGTTTATCAGCCGAACCATAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030749.1-490s21c1
Sequence:CCGGCAAGAGTGCGCTGGCCAAATTCTCGAGAATTTGGCCAGCGCACTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030749.1-226s1c1
Sequence:CCGGCCACCAGGAATCAGATACAAACTCGAGTTTGTATCTGATTCCTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030749.1-776s21c1
Sequence:CCGGGGCCTTCAAGTGGTGATTAATCTCGAGATTAATCACCACTTGAAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030749.1-699s21c1
Sequence:CCGGAGAAGGTTGCTGCGCTCTTTGCTCGAGCAAAGAGCGCAGCAACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030749.1-175s21c1
Sequence:CCGGCAGCTGTCAGAACTCAAATAACTCGAGTTATTTGAGTTCTGACAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030749.1-719s1c1
Sequence:CCGGGATCTTGAGTACTATGTCCATCTCGAGATGGACATAGTACTCAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030749.1-643s1c1
Sequence:CCGGGCAGATTATGGTTCGGCTGATCTCGAGATCAGCCGAACCATAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030749
VALIDATED
SIL1 MISSION shRNA Lentiviral Transduction Particles
SIL1 nucleotide exchange factor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030749.1-646s21c1
Sequence:CCGGGATTATGGTTCGGCTGATAAACTCGAGTTTATCAGCCGAACCATAATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030749.1-490s21c1
Sequence:CCGGCAAGAGTGCGCTGGCCAAATTCTCGAGAATTTGGCCAGCGCACTCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030749.1-226s1c1
Sequence:CCGGCCACCAGGAATCAGATACAAACTCGAGTTTGTATCTGATTCCTGGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030749.1-776s21c1
Sequence:CCGGGGCCTTCAAGTGGTGATTAATCTCGAGATTAATCACCACTTGAAGGCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_030749.1-699s21c1
Sequence:CCGGAGAAGGTTGCTGCGCTCTTTGCTCGAGCAAAGAGCGCAGCAACCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030749.1-175s21c1
Sequence:CCGGCAGCTGTCAGAACTCAAATAACTCGAGTTATTTGAGTTCTGACAGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000191112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030749.1-719s1c1
Sequence:CCGGGATCTTGAGTACTATGTCCATCTCGAGATGGACATAGTACTCAAGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030749.1-643s1c1
Sequence:CCGGGCAGATTATGGTTCGGCTGATCTCGAGATCAGCCGAACCATAATCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022464
VALIDATED
SIL1 MISSION shRNA Bacterial Glycerol Stock
SIL1 nucleotide exchange factor
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022464.4-720s21c1
Sequence:CCGGAGAAGATTGCTGCGCTCTTTGCTCGAGCAAAGAGCGCAGCAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022464.4-1596s21c1
Sequence:CCGGGTGCTGGCTTGGCCATTAAATCTCGAGATTTAATGGCCAAGCCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022464.3-883s1c1
Sequence:CCGGGCTCACTGCAAAGAAGAAGGTCTCGAGACCTTCTTCTTTGCAGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022464.3-1526s1c1
Sequence:CCGGGCCATTAAATGGAAACCTGAACTCGAGTTCAGGTTTCCATTTAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022464.4-633s21c1
Sequence:GTACCGGATGAGCTGAATGTTGTCATTGCTCGAGCAATGACAACATTCAGCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022464.4-798s21c1
Sequence:CCGGGTCTTCAAGTGGTGATCAATGCTCGAGCATTGATCACCACTTGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022464.4-437s21c1
Sequence:CCGGGAGGACAAGTTCCGAAATAATCTCGAGATTATTTCGGAACTTGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022464.3-530s1c1
Sequence:CCGGGAGGAACTGAAGAAAGACTTTCTCGAGAAAGTCTTTCTTCAGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022464.3-551s1c1
Sequence:CCGGGATGAGCTGAATGTTGTCATTCTCGAGAATGACAACATTCAGCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022464.3-308s1c1
Sequence:CCGGGTACGGCTGAATCTTCAGACTCTCGAGAGTCTGAAGATTCAGCCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_022464.3-638s1c1
Sequence:CCGGGAGAAGATTGCTGCGCTCTTTCTCGAGAAAGAGCGCAGCAATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022464.3-613s1c1
Sequence:CCGGCAATAGTTCCAGCTCCAGTTTCTCGAGAAACTGGAGCTGGAACTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022464.3-356s1c1
Sequence:CCGGGAGGACAAGTTCCGAAATAATCTCGAGATTATTTCGGAACTTGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022464
VALIDATED
SIL1 MISSION shRNA shRNA Plasmid DNA
SIL1 nucleotide exchange factor
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022464.4-720s21c1
Sequence:CCGGAGAAGATTGCTGCGCTCTTTGCTCGAGCAAAGAGCGCAGCAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022464.4-1596s21c1
Sequence:CCGGGTGCTGGCTTGGCCATTAAATCTCGAGATTTAATGGCCAAGCCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022464.3-883s1c1
Sequence:CCGGGCTCACTGCAAAGAAGAAGGTCTCGAGACCTTCTTCTTTGCAGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022464.3-1526s1c1
Sequence:CCGGGCCATTAAATGGAAACCTGAACTCGAGTTCAGGTTTCCATTTAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022464.4-633s21c1
Sequence:GTACCGGATGAGCTGAATGTTGTCATTGCTCGAGCAATGACAACATTCAGCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022464.4-798s21c1
Sequence:CCGGGTCTTCAAGTGGTGATCAATGCTCGAGCATTGATCACCACTTGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022464.4-437s21c1
Sequence:CCGGGAGGACAAGTTCCGAAATAATCTCGAGATTATTTCGGAACTTGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022464.3-530s1c1
Sequence:CCGGGAGGAACTGAAGAAAGACTTTCTCGAGAAAGTCTTTCTTCAGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022464.3-551s1c1
Sequence:CCGGGATGAGCTGAATGTTGTCATTCTCGAGAATGACAACATTCAGCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022464.3-308s1c1
Sequence:CCGGGTACGGCTGAATCTTCAGACTCTCGAGAGTCTGAAGATTCAGCCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_022464.3-638s1c1
Sequence:CCGGGAGAAGATTGCTGCGCTCTTTCTCGAGAAAGAGCGCAGCAATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022464.3-613s1c1
Sequence:CCGGCAATAGTTCCAGCTCCAGTTTCTCGAGAAACTGGAGCTGGAACTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022464.3-356s1c1
Sequence:CCGGGAGGACAAGTTCCGAAATAATCTCGAGATTATTTCGGAACTTGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022464
VALIDATED
SIL1 MISSION shRNA Lentiviral Transduction Particles
SIL1 nucleotide exchange factor
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022464.4-720s21c1
Sequence:CCGGAGAAGATTGCTGCGCTCTTTGCTCGAGCAAAGAGCGCAGCAATCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000230234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022464.4-1596s21c1
Sequence:CCGGGTGCTGGCTTGGCCATTAAATCTCGAGATTTAATGGCCAAGCCAGCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000140608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022464.3-883s1c1
Sequence:CCGGGCTCACTGCAAAGAAGAAGGTCTCGAGACCTTCTTCTTTGCAGTGAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000145439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022464.3-1526s1c1
Sequence:CCGGGCCATTAAATGGAAACCTGAACTCGAGTTCAGGTTTCCATTTAATGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000218058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022464.4-633s21c1
Sequence:GTACCGGATGAGCTGAATGTTGTCATTGCTCGAGCAATGACAACATTCAGCTCATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000230233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022464.4-798s21c1
Sequence:CCGGGTCTTCAAGTGGTGATCAATGCTCGAGCATTGATCACCACTTGAAGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000230231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022464.4-437s21c1
Sequence:CCGGGAGGACAAGTTCCGAAATAATCTCGAGATTATTTCGGAACTTGTCCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000145113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022464.3-530s1c1
Sequence:CCGGGAGGAACTGAAGAAAGACTTTCTCGAGAAAGTCTTTCTTCAGTTCCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000144562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_022464.3-551s1c1
Sequence:CCGGGATGAGCTGAATGTTGTCATTCTCGAGAATGACAACATTCAGCTCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000140270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022464.3-308s1c1
Sequence:CCGGGTACGGCTGAATCTTCAGACTCTCGAGAGTCTGAAGATTCAGCCGTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000140141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_022464.3-638s1c1
Sequence:CCGGGAGAAGATTGCTGCGCTCTTTCTCGAGAAAGAGCGCAGCAATCTTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000122335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022464.3-613s1c1
Sequence:CCGGCAATAGTTCCAGCTCCAGTTTCTCGAGAAACTGGAGCTGGAACTATTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000144912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022464.3-356s1c1
Sequence:CCGGGAGGACAAGTTCCGAAATAATCTCGAGATTATTTCGGAACTTGTCCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???