EMAIL THIS PAGE TO A FRIEND

SIM1

single-minded homolog 1 (Drosophila)

134 Gene Product Result for
Synonyms: bHLHe14
UniProtKB ID: P81133, Q5TDP7
Gene ID:
Human(6492) Summary: SIM1 and SIM2 genes are Drosophila single-minded (sim) gene homologs. SIM1 transcript was detected only in fetal kidney out of various adult and fetal tissues tested. Since the sim gene plays an important role in Drosophila development and has peak levels of expression during the period of neurogenesis,it was proposed that the human SIM gene is a candidate for involvement in certain dysmorphic features (particularly the facial and skull characteristics), abnormalities of brain development, and/or mental retardation of Down syndrome. [provided by RefSeq, Jul 2008]
Mouse(20464) single-minded homolog 1 (Drosophila)
Rat(309888) single-minded homolog 1 (Drosophila)
chicken(396129) single-minded homolog 1 (Drosophila)
domestic cat(101086396) single-minded homolog 1 (Drosophila)
Horse(100066172) single-minded homolog 1 (Drosophila)
dog(481937) single-minded homolog 1 (Drosophila)
cow(537223) single-minded homolog 1 (Drosophila)
sheep(101123562) single-minded homolog 1 (Drosophila)
Domestic Rabbit(100357074) single-minded homolog 1 (Drosophila)
naked mole-rat(101711620) single-minded homolog 1 (Drosophila)
domestic guinea pig(100732546) single-minded homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005068 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006441 MISSION® esiRNA esiRNA targeting human SIM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005068 Rosetta Predictions human pricing
NM_001107641 Rosetta Predictions rat pricing
NM_011376 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103197 predicted 2207
2 SASI_Hs01_00103198 predicted 1934
3 SASI_Hs01_00103199 predicted 1842
4 SASI_Hs01_00103200 predicted 2164
5 SASI_Hs01_00103201 predicted 2232
6 SASI_Hs01_00103202 predicted 2319
7 SASI_Hs02_00338895 predicted 2583
8 SASI_Hs01_00103203 predicted 2391
9 SASI_Hs01_00103204 predicted 2329
10 SASI_Hs01_00103205 predicted 311
11 SASI_Hs01_00103206 predicted 2090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230835 predicted 2643
2 SASI_Rn02_00230836 predicted 2340
3 SASI_Rn02_00230837 predicted 2617
4 SASI_Rn02_00230838 predicted 969
5 SASI_Rn02_00230839 predicted 1299
6 SASI_Rn02_00230840 predicted 645
7 SASI_Rn02_00230841 predicted 1709
8 SASI_Rn02_00230842 predicted 1347
9 SASI_Rn02_00230843 predicted 2440
10 SASI_Rn02_00230844 predicted 2415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146955 predicted 787
2 SASI_Mm01_00146956 predicted 1242
3 SASI_Mm01_00146958 predicted 1162
4 SASI_Mm01_00146959 predicted 1531
5 SASI_Mm01_00146960 predicted 2259
6 SASI_Mm02_00320554 predicted 2452
7 SASI_Mm01_00146961 predicted 2396
8 SASI_Mm01_00146962 predicted 2242
9 SASI_Mm01_00146963 predicted 2370
10 SASI_Mm01_00146964 predicted 1083
11 SASI_Mm01_00146957 predicted 1983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005068
SIM1 MISSION shRNA Bacterial Glycerol Stock
single-minded homolog 1 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005068.2-1200s1c1
Sequence:CCGGCCTCACAGACACAGAATACAACTCGAGTTGTATTCTGTGTCTGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005068.2-1178s21c1
Sequence:CCGGGTATCGTCAGCGTCAACTATGCTCGAGCATAGTTGACGCTGACGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005068.2-2335s1c1
Sequence:CCGGGCTTACACATTAACTGGATATCTCGAGATATCCAGTTAATGTGTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005068.2-2590s1c1
Sequence:CCGGCCACAGATTGTTAGAGAGTATCTCGAGATACTCTCTAACAATCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005068.2-273s1c1
Sequence:CCGGACTGGCTAAATTACTGCCTTTCTCGAGAAAGGCAGTAATTTAGCCAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005068.2-2165s1c1
Sequence:CCGGCCGCACTATCTCGGATAAGTACTCGAGTACTTATCCGAGATAGTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005068.2-2303s21c1
Sequence:CCGGTTGGCTCTCACCGGCAGTATTCTCGAGAATACTGCCGGTGAGAGCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005068
SIM1 MISSION shRNA shRNA Plasmid DNA
single-minded homolog 1 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005068.2-1200s1c1
Sequence:CCGGCCTCACAGACACAGAATACAACTCGAGTTGTATTCTGTGTCTGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005068.2-1178s21c1
Sequence:CCGGGTATCGTCAGCGTCAACTATGCTCGAGCATAGTTGACGCTGACGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005068.2-2335s1c1
Sequence:CCGGGCTTACACATTAACTGGATATCTCGAGATATCCAGTTAATGTGTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005068.2-2590s1c1
Sequence:CCGGCCACAGATTGTTAGAGAGTATCTCGAGATACTCTCTAACAATCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005068.2-273s1c1
Sequence:CCGGACTGGCTAAATTACTGCCTTTCTCGAGAAAGGCAGTAATTTAGCCAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005068.2-2165s1c1
Sequence:CCGGCCGCACTATCTCGGATAAGTACTCGAGTACTTATCCGAGATAGTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005068.2-2303s21c1
Sequence:CCGGTTGGCTCTCACCGGCAGTATTCTCGAGAATACTGCCGGTGAGAGCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005068
SIM1 MISSION shRNA Lentiviral Transduction Particles
single-minded homolog 1 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005068.2-1200s1c1
Sequence:CCGGCCTCACAGACACAGAATACAACTCGAGTTGTATTCTGTGTCTGTGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005068.2-1178s21c1
Sequence:CCGGGTATCGTCAGCGTCAACTATGCTCGAGCATAGTTGACGCTGACGATACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005068.2-2335s1c1
Sequence:CCGGGCTTACACATTAACTGGATATCTCGAGATATCCAGTTAATGTGTAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005068.2-2590s1c1
Sequence:CCGGCCACAGATTGTTAGAGAGTATCTCGAGATACTCTCTAACAATCTGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005068.2-273s1c1
Sequence:CCGGACTGGCTAAATTACTGCCTTTCTCGAGAAAGGCAGTAATTTAGCCAGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005068.2-2165s1c1
Sequence:CCGGCCGCACTATCTCGGATAAGTACTCGAGTACTTATCCGAGATAGTGCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005068.2-2303s21c1
Sequence:CCGGTTGGCTCTCACCGGCAGTATTCTCGAGAATACTGCCGGTGAGAGCCAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011376
SIM1 MISSION shRNA Bacterial Glycerol Stock
single-minded homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011376.3-1532s21c1
Sequence:CCGGACGAATTGTCCTGTGCGTATACTCGAGTATACGCACAGGACAATTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011376.1-842s1c1
Sequence:CCGGCCTTTGATGGATGCTACCAAACTCGAGTTTGGTAGCATCCATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011376.1-5751s1c1
Sequence:CCGGCCACTTATTATTTCCTGGTTACTCGAGTAACCAGGAAATAATAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011376.1-1365s1c1
Sequence:CCGGGCTCTCCAGTAGCAAGTCAAACTCGAGTTTGACTTGCTACTGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011376.1-2222s1c1
Sequence:CCGGCTAGTTCTGATCGCATTACAACTCGAGTTGTAATGCGATCAGAACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011376.1-1415s1c1
Sequence:CCGGCGGGATTCCATACTGAGAGATCTCGAGATCTCTCAGTATGGAATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011376.3-2701s21c1
Sequence:CCGGCACCGACATTCAAGGTTATACCTCGAGGTATAACCTTGAATGTCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011376.3-2198s21c1
Sequence:CCGGCCACTGCACTGTCTCGGATAACTCGAGTTATCCGAGACAGTGCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011376
SIM1 MISSION shRNA shRNA Plasmid DNA
single-minded homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011376.3-1532s21c1
Sequence:CCGGACGAATTGTCCTGTGCGTATACTCGAGTATACGCACAGGACAATTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011376.1-842s1c1
Sequence:CCGGCCTTTGATGGATGCTACCAAACTCGAGTTTGGTAGCATCCATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011376.1-5751s1c1
Sequence:CCGGCCACTTATTATTTCCTGGTTACTCGAGTAACCAGGAAATAATAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011376.1-1365s1c1
Sequence:CCGGGCTCTCCAGTAGCAAGTCAAACTCGAGTTTGACTTGCTACTGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011376.1-2222s1c1
Sequence:CCGGCTAGTTCTGATCGCATTACAACTCGAGTTGTAATGCGATCAGAACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011376.1-1415s1c1
Sequence:CCGGCGGGATTCCATACTGAGAGATCTCGAGATCTCTCAGTATGGAATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011376.3-2701s21c1
Sequence:CCGGCACCGACATTCAAGGTTATACCTCGAGGTATAACCTTGAATGTCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011376.3-2198s21c1
Sequence:CCGGCCACTGCACTGTCTCGGATAACTCGAGTTATCCGAGACAGTGCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011376
SIM1 MISSION shRNA Lentiviral Transduction Particles
single-minded homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011376.3-1532s21c1
Sequence:CCGGACGAATTGTCCTGTGCGTATACTCGAGTATACGCACAGGACAATTCGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011376.1-842s1c1
Sequence:CCGGCCTTTGATGGATGCTACCAAACTCGAGTTTGGTAGCATCCATCAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011376.1-5751s1c1
Sequence:CCGGCCACTTATTATTTCCTGGTTACTCGAGTAACCAGGAAATAATAAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011376.1-1365s1c1
Sequence:CCGGGCTCTCCAGTAGCAAGTCAAACTCGAGTTTGACTTGCTACTGGAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011376.1-2222s1c1
Sequence:CCGGCTAGTTCTGATCGCATTACAACTCGAGTTGTAATGCGATCAGAACTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011376.1-1415s1c1
Sequence:CCGGCGGGATTCCATACTGAGAGATCTCGAGATCTCTCAGTATGGAATCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011376.3-2701s21c1
Sequence:CCGGCACCGACATTCAAGGTTATACCTCGAGGTATAACCTTGAATGTCGGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011376.3-2198s21c1
Sequence:CCGGCCACTGCACTGTCTCGGATAACTCGAGTTATCCGAGACAGTGCAGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)