EMAIL THIS PAGE TO A FRIEND

SIM2

single-minded homolog 2 (Drosophila)

69 Gene Product Result for
Synonyms: HMC13F06 HMC29C01 SIM bHLHe15
Gene ID:
Human(6493) Summary: SIM1 and SIM2 genes are Drosophila single-minded (sim) gene homologs. The Drosophila sim gene encodes a transcription factor that is a master regulator of fruit fly neurogenesis. SIM2 maps within the so-called Down syndrome chromosomal region. Based on the mapping position, its potential function as transcriptional repressor and similarity to Drosophila sim, it is proposed that SIM2 may contribute to some specific Down syndrome phenotypes [provided by RefSeq, Jul 2008]
Mouse(20465) single-minded homolog 2 (Drosophila)
Rat(304071) single-minded homolog 2 (Drosophila)
Zebrafish(114450) single-minded homolog 2 (Drosophila)
dog(607987) single-minded homolog 2 (Drosophila)
Horse(100061169) single-minded homolog 2 (Drosophila)
domestic cat(101101246) single-minded homolog 2 (Drosophila)
chicken(418515) single-minded homolog 2 (Drosophila)
domestic guinea pig(100726259) single-minded homolog 2 (Drosophila)
naked mole-rat(101723547) single-minded homolog 2 (Drosophila)
cow(100337422) single-minded homolog 2 (Drosophila)
sheep(101109328) single-minded homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005069 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU090261 MISSION® esiRNA esiRNA targeting mouse Sim2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005069 Rosetta Predictions human pricing
NM_009586 Rosetta Predictions human pricing
NM_001107108 Rosetta Predictions rat pricing
NM_011377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041217 predicted 886
2 SASI_Hs01_00041218 predicted 514
3 SASI_Hs01_00041219 predicted 405
4 SASI_Hs01_00041220 predicted 297
5 SASI_Hs02_00338896 predicted 524
6 SASI_Hs01_00041223 predicted 436
7 SASI_Hs01_00041224 predicted 724
8 SASI_Hs02_00338897 predicted 329
9 SASI_Hs01_00041225 predicted 772
10 SASI_Hs01_00041226 predicted 826
11 SASI_Hs01_00041221 predicted 379
12 SASI_Hs01_00041222 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171503 predicted 894
2 SASI_Hs01_00171504 predicted 509
3 SASI_Hs01_00171505 predicted 402
4 SASI_Hs01_00171506 predicted 291
5 SASI_Hs02_00343512 predicted 520
6 SASI_Hs01_00171509 predicted 434
7 SASI_Hs01_00171510 predicted 720
8 SASI_Hs02_00343513 predicted 334
9 SASI_Hs01_00171511 predicted 770
10 SASI_Hs01_00171512 predicted 830
11 SASI_Hs01_00171507 predicted 379
12 SASI_Hs01_00171508 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225576 predicted 2498
2 SASI_Rn02_00225577 predicted 2097
3 SASI_Rn02_00225578 predicted 2187
4 SASI_Rn02_00225579 predicted 1398
5 SASI_Rn02_00225580 predicted 1498
6 SASI_Rn02_00225581 predicted 1690
7 SASI_Rn02_00225582 predicted 1266
8 SASI_Rn02_00225583 predicted 1255
9 SASI_Rn02_00225584 predicted 2108
10 SASI_Rn02_00225585 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110927 predicted 1629
2 SASI_Mm02_00320555 predicted 1020
3 SASI_Mm01_00110931 predicted 858
4 SASI_Mm01_00110934 predicted 1218
5 SASI_Mm01_00110936 predicted 1273
6 SASI_Mm02_00320556 predicted 1641
7 SASI_Mm02_00320557 predicted 1897
8 SASI_Mm02_00320558 predicted 1139
9 SASI_Mm02_00320559 predicted 1534
10 SASI_Mm02_00320560 predicted 810
11 SASI_Mm01_00110928 predicted 1129
12 SASI_Mm01_00110929 predicted 2925
13 SASI_Mm01_00110930 predicted 2919
14 SASI_Mm01_00110932 predicted 2935
15 SASI_Mm01_00110933 predicted 1358
16 SASI_Mm01_00110935 predicted 1131
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005069
SIM2 MISSION shRNA Bacterial Glycerol Stock
single-minded homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005069.3-658s21c1
Sequence:CCGGACGACTCCTGCTACCAGATTGCTCGAGCAATCTGGTAGCAGGAGTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005069.3-520s21c1
Sequence:CCGGAGATAGAGAGGTCGTTCTTTCCTCGAGGAAAGAACGACCTCTCTATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005069.2-833s1c1
Sequence:CCGGCCTGATCGAGAAGACCCTATACTCGAGTATAGGGTCTTCTCGATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005069.2-415s1c1
Sequence:CCGGCGGGCAACAGTATTTATGAATCTCGAGATTCATAAATACTGTTGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005069.2-308s1c1
Sequence:CCGGGCTGCAGACTTTGGATGGATTCTCGAGAATCCATCCAAAGTCTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005069.2-1131s1c1
Sequence:CCGGGCCTTGTCTACCTCACAAGAACTCGAGTTCTTGTGAGGTAGACAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005069.2-2854s1c1
Sequence:CCGGGCTTCATTATTACGTGGCAAACTCGAGTTTGCCACGTAATAATGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005069
SIM2 MISSION shRNA shRNA Plasmid DNA
single-minded homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005069.3-658s21c1
Sequence:CCGGACGACTCCTGCTACCAGATTGCTCGAGCAATCTGGTAGCAGGAGTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005069.3-520s21c1
Sequence:CCGGAGATAGAGAGGTCGTTCTTTCCTCGAGGAAAGAACGACCTCTCTATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005069.2-833s1c1
Sequence:CCGGCCTGATCGAGAAGACCCTATACTCGAGTATAGGGTCTTCTCGATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005069.2-415s1c1
Sequence:CCGGCGGGCAACAGTATTTATGAATCTCGAGATTCATAAATACTGTTGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005069.2-308s1c1
Sequence:CCGGGCTGCAGACTTTGGATGGATTCTCGAGAATCCATCCAAAGTCTGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005069.2-1131s1c1
Sequence:CCGGGCCTTGTCTACCTCACAAGAACTCGAGTTCTTGTGAGGTAGACAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005069.2-2854s1c1
Sequence:CCGGGCTTCATTATTACGTGGCAAACTCGAGTTTGCCACGTAATAATGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005069
SIM2 MISSION shRNA Lentiviral Transduction Particles
single-minded homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005069.3-658s21c1
Sequence:CCGGACGACTCCTGCTACCAGATTGCTCGAGCAATCTGGTAGCAGGAGTCGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005069.3-520s21c1
Sequence:CCGGAGATAGAGAGGTCGTTCTTTCCTCGAGGAAAGAACGACCTCTCTATCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005069.2-833s1c1
Sequence:CCGGCCTGATCGAGAAGACCCTATACTCGAGTATAGGGTCTTCTCGATCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005069.2-415s1c1
Sequence:CCGGCGGGCAACAGTATTTATGAATCTCGAGATTCATAAATACTGTTGCCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005069.2-308s1c1
Sequence:CCGGGCTGCAGACTTTGGATGGATTCTCGAGAATCCATCCAAAGTCTGCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005069.2-1131s1c1
Sequence:CCGGGCCTTGTCTACCTCACAAGAACTCGAGTTCTTGTGAGGTAGACAAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005069.2-2854s1c1
Sequence:CCGGGCTTCATTATTACGTGGCAAACTCGAGTTTGCCACGTAATAATGAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011377
SIM2 MISSION shRNA Bacterial Glycerol Stock
single-minded homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011377.1-1359s1c1
Sequence:CCGGGCGGTCTTTCTTTCTTCGAATCTCGAGATTCGAAGAAAGAAAGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011377.1-1452s1c1
Sequence:CCGGCCTAAAGATCAGACAGTACATCTCGAGATGTACTGTCTGATCTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011377.1-3699s1c1
Sequence:CCGGCGCTTATATTTGCTTGCGATTCTCGAGAATCGCAAGCAAATATAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011377.1-1599s1c1
Sequence:CCGGCCTTGACCTGAAGCTCATATTCTCGAGAATATGAGCTTCAGGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011377.1-2919s1c1
Sequence:CCGGGCGAACTGTATATGCACGATACTCGAGTATCGTGCATATACAGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011377
SIM2 MISSION shRNA shRNA Plasmid DNA
single-minded homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011377.1-1359s1c1
Sequence:CCGGGCGGTCTTTCTTTCTTCGAATCTCGAGATTCGAAGAAAGAAAGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011377.1-1452s1c1
Sequence:CCGGCCTAAAGATCAGACAGTACATCTCGAGATGTACTGTCTGATCTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011377.1-3699s1c1
Sequence:CCGGCGCTTATATTTGCTTGCGATTCTCGAGAATCGCAAGCAAATATAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011377.1-1599s1c1
Sequence:CCGGCCTTGACCTGAAGCTCATATTCTCGAGAATATGAGCTTCAGGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011377.1-2919s1c1
Sequence:CCGGGCGAACTGTATATGCACGATACTCGAGTATCGTGCATATACAGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011377
SIM2 MISSION shRNA Lentiviral Transduction Particles
single-minded homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011377.1-1359s1c1
Sequence:CCGGGCGGTCTTTCTTTCTTCGAATCTCGAGATTCGAAGAAAGAAAGACCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011377.1-1452s1c1
Sequence:CCGGCCTAAAGATCAGACAGTACATCTCGAGATGTACTGTCTGATCTTTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011377.1-3699s1c1
Sequence:CCGGCGCTTATATTTGCTTGCGATTCTCGAGAATCGCAAGCAAATATAAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011377.1-1599s1c1
Sequence:CCGGCCTTGACCTGAAGCTCATATTCTCGAGAATATGAGCTTCAGGTCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011377.1-2919s1c1
Sequence:CCGGGCGAACTGTATATGCACGATACTCGAGTATCGTGCATATACAGTTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)