EMAIL THIS PAGE TO A FRIEND

SIRPG

signal-regulatory protein gamma

88 Gene Product Result for
Synonyms: CD172g SIRP-B2 SIRPB2 SIRPgamma bA77C3.1
Species: Human SIRPG(55423), domestic guinea pig Sirpg(100717961)
Gene ID:
Human(55423) Summary: The protein encoded by this gene is a member of the signal-regulatory protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
domestic guinea pig(100717961) signal-regulatory protein gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018556 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039508 Rosetta Predictions human pricing
NM_018556 Rosetta Predictions human pricing
NM_080816 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051368 predicted 1167
2 SASI_Hs01_00051370 predicted 1080
3 SASI_Hs01_00051371 predicted 246
4 SASI_Hs01_00051372 predicted 1048
5 SASI_Hs01_00051373 predicted 1131
6 SASI_Hs01_00051374 predicted 1048
7 SASI_Hs01_00051375 predicted 1134
8 SASI_Hs01_00051376 predicted 1053
9 SASI_Hs02_00308551 predicted 250
10 SASI_Hs02_00308552 predicted 237
11 SASI_Hs01_00051369 predicted 1094
12 SASI_Hs01_00051377 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242528 predicted 1495
2 SASI_Hs01_00242530 predicted 1412
3 SASI_Hs01_00242531 predicted 248
4 SASI_Hs01_00242532 predicted 1381
5 SASI_Hs01_00242533 predicted 1456
6 SASI_Hs01_00242534 predicted 1383
7 SASI_Hs01_00242535 predicted 1469
8 SASI_Hs01_00242536 predicted 1378
9 SASI_Hs02_00352104 predicted 252
10 SASI_Hs02_00352105 predicted 242
11 SASI_Hs01_00242529 predicted 1423
12 SASI_Hs01_00242537 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226629 predicted 849
2 SASI_Hs01_00226631 predicted 765
3 SASI_Hs01_00226632 predicted 247
4 SASI_Hs01_00226633 predicted 727
5 SASI_Hs01_00226634 predicted 811
6 SASI_Hs01_00226635 predicted 733
7 SASI_Hs01_00226636 predicted 815
8 SASI_Hs01_00226637 predicted 727
9 SASI_Hs02_00362585 predicted 245
10 SASI_Hs02_00362586 predicted 242
11 SASI_Hs01_00226630 predicted 770
12 SASI_Hs01_00226638 predicted 730
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018556
SIRPG MISSION shRNA Bacterial Glycerol Stock
signal-regulatory protein gamma
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-420s1c1
Sequence:CCGGCCCTGAGAACGTGGAGTTTAACTCGAGTTAAACTCCACGTTCTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-985s1c1
Sequence:CCGGCTGGTGAACATATCTGACCAACTCGAGTTGGTCAGATATGTTCACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-384s1c1
Sequence:CCGGCGGCACATACTACTGTGTGAACTCGAGTTCACACAGTAGTATGTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-321s1c1
Sequence:CCGGCCTCACAAAGAGAAACAACATCTCGAGATGTTGTTTCTCTTTGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-457s1c1
Sequence:CCGGGAGATGGCTTTGGGTGCCAAACTCGAGTTTGGCACCCAAAGCCATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018556.3-1162s21c1
Sequence:CCGGTTACTGCGCTGCTCCTCATAGCTCGAGCTATGAGGAGCAGCGCAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018556.3-1546s21c1
Sequence:CCGGCGCCTTGAGACTGACCGTAAACTCGAGTTTACGGTCAGTCTCAAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018556
SIRPG MISSION shRNA shRNA Plasmid DNA
signal-regulatory protein gamma
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-420s1c1
Sequence:CCGGCCCTGAGAACGTGGAGTTTAACTCGAGTTAAACTCCACGTTCTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-985s1c1
Sequence:CCGGCTGGTGAACATATCTGACCAACTCGAGTTGGTCAGATATGTTCACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-384s1c1
Sequence:CCGGCGGCACATACTACTGTGTGAACTCGAGTTCACACAGTAGTATGTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-321s1c1
Sequence:CCGGCCTCACAAAGAGAAACAACATCTCGAGATGTTGTTTCTCTTTGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-457s1c1
Sequence:CCGGGAGATGGCTTTGGGTGCCAAACTCGAGTTTGGCACCCAAAGCCATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018556.3-1162s21c1
Sequence:CCGGTTACTGCGCTGCTCCTCATAGCTCGAGCTATGAGGAGCAGCGCAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018556.3-1546s21c1
Sequence:CCGGCGCCTTGAGACTGACCGTAAACTCGAGTTTACGGTCAGTCTCAAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018556
SIRPG MISSION shRNA Lentiviral Transduction Particles
signal-regulatory protein gamma
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-420s1c1
Sequence:CCGGCCCTGAGAACGTGGAGTTTAACTCGAGTTAAACTCCACGTTCTCAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-985s1c1
Sequence:CCGGCTGGTGAACATATCTGACCAACTCGAGTTGGTCAGATATGTTCACCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-384s1c1
Sequence:CCGGCGGCACATACTACTGTGTGAACTCGAGTTCACACAGTAGTATGTGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-321s1c1
Sequence:CCGGCCTCACAAAGAGAAACAACATCTCGAGATGTTGTTTCTCTTTGTGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018556.2-457s1c1
Sequence:CCGGGAGATGGCTTTGGGTGCCAAACTCGAGTTTGGCACCCAAAGCCATCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018556.3-1162s21c1
Sequence:CCGGTTACTGCGCTGCTCCTCATAGCTCGAGCTATGAGGAGCAGCGCAGTAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018556.3-1546s21c1
Sequence:CCGGCGCCTTGAGACTGACCGTAAACTCGAGTTTACGGTCAGTCTCAAGGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)