EMAIL THIS PAGE TO A FRIEND

SIRT1

sirtuin 1

200 Gene Product Result for
Synonyms: SIR2L1
UniProtKB ID: Q96EB6, Q2XNF6, Q5JVQ0, Q9GZR9, Q9Y6F0
Gene ID:
Human(23411) Summary: This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Mouse(93759) sirtuin 1
Rat(309757) sirtuin 1
cow(613629) sirtuin 1
sheep(101102956) sirtuin 1
Zebrafish(797132) sirtuin (silent mating type information regulation 2 homolog) 1
chicken(423646) sirtuin 1
dog(489012) sirtuin 1
Horse(100072571) sirtuin 1
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
ABE1392 Anti-phospho SIRT1 (Ser682) Antibody Anti-phospho SIRT1 (Ser682) Antibody, Cat. No. ABE1392, is a highly specific rabbit Polyclonal antibody, that targets SIRT1 and has been tested in Western Blotting. human, human
western blot pricing
SAB4301426 Anti-phospho-SirT1 (pSer47) antibody produced in rabbit affinity isolated antibody human
western blot pricing
S5313 Anti-Sir2 (AS-16) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
immunofluorescence, microarray, western blot pricing
S5322 Anti-Sirt1 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB3500493 Anti-SIRT1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, western blot pricing
SAB2501994 Anti-SIRT1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
HPA006295 Anti-SIRT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV32386 Anti-SIRT1 antibody produced in rabbit affinity isolated antibody rat, dog, guinea pig, rabbit, horse, bovine, mouse, human
western blot pricing
S5447 Anti-SIRT1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunoprecipitation (IP), western blot pricing
HPA052351 Anti-SIRT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
04-1557 Anti-SIRT1 Antibody, clone 10E4 Use Anti-SIRT1 Antibody, clone 10E4 (mouse monoclonal antibody) validated in WB, IP, ICC, IHC, ChIP to detect SIRT1 also known as sirtuin (silent mating type information regulation 2 homolog) 1, sirtuin 1. mouse, human, human
ChIP, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
05-1243 Anti-Sirt1 Antibody, clone 3H10.2 Anti-Sirt1 Antibody, clone 3H10.2 is a Mouse Monoclonal Antibody for detection of Sirt1 also known as Sirtuin 1, Silent mating type Information Regulation-2 & has been tested in IP & WB. human
immunoprecipitation (IP), western blot pricing
S5196 Anti-Sirt1 antibody, Mouse monoclonal clone SIR11, purified from hybridoma cell culture mouse
ELISA, microarray, western blot pricing
WH0023411M1 Monoclonal Anti-SIRT1 antibody produced in mouse clone 7B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB4200648 Monoclonal Anti-SIRT1 antibody produced in mouse clone SIRT1-1, purified from hybridoma cell culture human
flow cytometry, immunoprecipitation (IP), western blot pricing
SAB1404972 Monoclonal Anti-SIRT1, (C-terminal) antibody produced in mouse clone 7C2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0132 Rabbit anti-Sirt1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunoprecipitation (IP), western blot pricing

Small Molecule - Activator

Product # Description Species Add to Cart
 
R5010 Resveratrol ≥99% (HPLC) human, mouse, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S7942 Sirtinol ≥95% (HPLC) human pricing

ELISA

Product # Description Species Add to Cart
 
RAB1699 Human SIRT1 ELISA human pricing

Activity Assay

Product # Description Species Add to Cart
 
CS1040 SIRT1 Assay Kit sufficient for 100 assays human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012238 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU000411 MISSION® esiRNA esiRNA targeting mouse Sirt1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012238 Rosetta Predictions human pricing
NM_001107627 Rosetta Predictions rat pricing
NM_019812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153666 predicted 1134
2 SASI_Hs01_00153667 predicted 1189
3 SASI_Hs01_00153668 predicted 1070
4 SASI_Hs01_00153669 predicted 1788
5 SASI_Hs01_00153671 predicted 2226
6 SASI_Hs01_00153672 predicted 1412
7 SASI_Hs02_00343927 predicted 1219
8 SASI_Hs01_00153674 predicted 1729
9 SASI_Hs01_00153675 predicted 2264
10 SASI_Hs02_00343928 predicted 1495
11 SASI_Hs01_00153670 predicted 2240
12 SASI_Hs01_00153673 predicted 2054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230695 predicted 202
2 SASI_Rn02_00230696 predicted 217
3 SASI_Rn02_00230697 predicted 384
4 SASI_Rn02_00230698 predicted 309
5 SASI_Rn02_00230699 predicted 231
6 SASI_Rn02_00230700 predicted 233
7 SASI_Rn02_00230701 predicted 207
8 SASI_Rn02_00230702 predicted 281
9 SASI_Rn02_00230703 predicted 400
10 SASI_Rn02_00230704 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105672 predicted 761
2 SASI_Mm01_00105674 predicted 906
3 SASI_Mm01_00105675 predicted 1034
4 SASI_Mm02_00325084 predicted 1085
5 SASI_Mm01_00105676 predicted 1367
6 SASI_Mm01_00105677 predicted 1389
7 SASI_Mm01_00105678 predicted 1512
8 SASI_Mm01_00105679 predicted 1505
9 SASI_Mm01_00105680 predicted 1668
10 SASI_Mm01_00105681 predicted 2193
11 SASI_Mm01_00105673 predicted 1333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019812
VALIDATED
SIRT1 MISSION shRNA Bacterial Glycerol Stock
sirtuin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019812.2-1944s21c1
Sequence:CCGGGAGGGTAATCAATACCTGTTTCTCGAGAAACAGGTATTGATTACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019812.2-921s21c1
Sequence:CCGGGCCATGTTTGATATTGAGTATCTCGAGATACTCAATATCAAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019812.2-1370s21c1
Sequence:CCGGAGTGAGACCAGTAGCACTAATCTCGAGATTAGTGCTACTGGTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019812.2-2617s21c1
Sequence:CCGGCTAGACCAAAGAATGGTATTTCTCGAGAAATACCATTCTTTGGTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-1296s1c1
Sequence:CCGGGCCATGAAGTATGACAAAGATCTCGAGATCTTTGTCATACTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-1644s1c1
Sequence:CCGGCCTGAAAGAACTGTACCACAACTCGAGTTGTGGTACAGTTCTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-1929s1c1
Sequence:CCGGGAGGGTAATCAATACCTGTTTCTCGAGAAACAGGTATTGATTACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019812.2-1659s21c1
Sequence:CCGGCCTGAAAGAACTGTACCACAACTCGAGTTGTGGTACAGTTCTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-906s1c1
Sequence:CCGGGCCATGTTTGATATTGAGTATCTCGAGATACTCAATATCAAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-562s1c1
Sequence:CCGGCGCGGATAGGTCCATATACTTCTCGAGAAGTATATGGACCTATCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019812
VALIDATED
SIRT1 MISSION shRNA shRNA Plasmid DNA
sirtuin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019812.2-1944s21c1
Sequence:CCGGGAGGGTAATCAATACCTGTTTCTCGAGAAACAGGTATTGATTACCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019812.2-921s21c1
Sequence:CCGGGCCATGTTTGATATTGAGTATCTCGAGATACTCAATATCAAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019812.2-1370s21c1
Sequence:CCGGAGTGAGACCAGTAGCACTAATCTCGAGATTAGTGCTACTGGTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019812.2-2617s21c1
Sequence:CCGGCTAGACCAAAGAATGGTATTTCTCGAGAAATACCATTCTTTGGTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-1296s1c1
Sequence:CCGGGCCATGAAGTATGACAAAGATCTCGAGATCTTTGTCATACTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-1644s1c1
Sequence:CCGGCCTGAAAGAACTGTACCACAACTCGAGTTGTGGTACAGTTCTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-1929s1c1
Sequence:CCGGGAGGGTAATCAATACCTGTTTCTCGAGAAACAGGTATTGATTACCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019812.2-1659s21c1
Sequence:CCGGCCTGAAAGAACTGTACCACAACTCGAGTTGTGGTACAGTTCTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-906s1c1
Sequence:CCGGGCCATGTTTGATATTGAGTATCTCGAGATACTCAATATCAAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-562s1c1
Sequence:CCGGCGCGGATAGGTCCATATACTTCTCGAGAAGTATATGGACCTATCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019812
VALIDATED
SIRT1 MISSION shRNA Lentiviral Transduction Particles
sirtuin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019812.2-1944s21c1
Sequence:CCGGGAGGGTAATCAATACCTGTTTCTCGAGAAACAGGTATTGATTACCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019812.2-921s21c1
Sequence:CCGGGCCATGTTTGATATTGAGTATCTCGAGATACTCAATATCAAACATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019812.2-1370s21c1
Sequence:CCGGAGTGAGACCAGTAGCACTAATCTCGAGATTAGTGCTACTGGTCTCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019812.2-2617s21c1
Sequence:CCGGCTAGACCAAAGAATGGTATTTCTCGAGAAATACCATTCTTTGGTCTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-1296s1c1
Sequence:CCGGGCCATGAAGTATGACAAAGATCTCGAGATCTTTGTCATACTTCATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-1644s1c1
Sequence:CCGGCCTGAAAGAACTGTACCACAACTCGAGTTGTGGTACAGTTCTTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-1929s1c1
Sequence:CCGGGAGGGTAATCAATACCTGTTTCTCGAGAAACAGGTATTGATTACCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019812.2-1659s21c1
Sequence:CCGGCCTGAAAGAACTGTACCACAACTCGAGTTGTGGTACAGTTCTTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-906s1c1
Sequence:CCGGGCCATGTTTGATATTGAGTATCTCGAGATACTCAATATCAAACATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019812.1-562s1c1
Sequence:CCGGCGCGGATAGGTCCATATACTTCTCGAGAAGTATATGGACCTATCCGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012238
VALIDATED
SIRT1 MISSION shRNA Bacterial Glycerol Stock
sirtuin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012238.3-2217s21c1
Sequence:CCGGGATGATCAAGAGGCAATTAATCTCGAGATTAATTGCCTCTTGATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012238.3-1422s21c1
Sequence:GTACCGGCATGAAGTGCCTCAGATATTACTCGAGTAATATCTGAGGCACTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012238.3-3757s21c1
Sequence:CCGGTGGCCATTTCCCTACTTATAACTCGAGTTATAAGTAGGGAAATGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012238.3-1492s21c1
Sequence:CCGGGAGACTGTGATGTCATAATTACTCGAGTAATTATGACATCACAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_012238.3-645s1c1
Sequence:CCGGCCTCGAACAATTCTTAAAGATCTCGAGATCTTTAAGAATTGTTCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_012238.3-1113s1c1
Sequence:CCGGGCGGGAATCCAAAGGATAATTCTCGAGAATTATCCTTTGGATTCCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_012238.3-1958s1c1
Sequence:CCGGGCGGCTTGATGGTAATCAGTACTCGAGTACTGATTACCATCAAGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_012238.3-3206s1c1
Sequence:CCGGGCAAAGCCTTTCTGAATCTATCTCGAGATAGATTCAGAAAGGCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012238.3-497s1c1
Sequence:CCGGCGGTGATGAAATTATCACTAACTCGAGTTAGTGATAATTTCATCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012238.3-872s21c1
Sequence:CCGGCAGGTCAAGGGATGGTATTTACTCGAGTAAATACCATCCCTTGACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012238
VALIDATED
SIRT1 MISSION shRNA shRNA Plasmid DNA
sirtuin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012238.3-2217s21c1
Sequence:CCGGGATGATCAAGAGGCAATTAATCTCGAGATTAATTGCCTCTTGATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012238.3-1422s21c1
Sequence:GTACCGGCATGAAGTGCCTCAGATATTACTCGAGTAATATCTGAGGCACTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012238.3-3757s21c1
Sequence:CCGGTGGCCATTTCCCTACTTATAACTCGAGTTATAAGTAGGGAAATGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012238.3-1492s21c1
Sequence:CCGGGAGACTGTGATGTCATAATTACTCGAGTAATTATGACATCACAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_012238.3-645s1c1
Sequence:CCGGCCTCGAACAATTCTTAAAGATCTCGAGATCTTTAAGAATTGTTCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_012238.3-1113s1c1
Sequence:CCGGGCGGGAATCCAAAGGATAATTCTCGAGAATTATCCTTTGGATTCCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_012238.3-1958s1c1
Sequence:CCGGGCGGCTTGATGGTAATCAGTACTCGAGTACTGATTACCATCAAGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_012238.3-3206s1c1
Sequence:CCGGGCAAAGCCTTTCTGAATCTATCTCGAGATAGATTCAGAAAGGCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012238.3-497s1c1
Sequence:CCGGCGGTGATGAAATTATCACTAACTCGAGTTAGTGATAATTTCATCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012238.3-872s21c1
Sequence:CCGGCAGGTCAAGGGATGGTATTTACTCGAGTAAATACCATCCCTTGACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012238
VALIDATED
SIRT1 MISSION shRNA Lentiviral Transduction Particles
sirtuin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012238.3-2217s21c1
Sequence:CCGGGATGATCAAGAGGCAATTAATCTCGAGATTAATTGCCTCTTGATCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012238.3-1422s21c1
Sequence:GTACCGGCATGAAGTGCCTCAGATATTACTCGAGTAATATCTGAGGCACTTCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012238.3-3757s21c1
Sequence:CCGGTGGCCATTTCCCTACTTATAACTCGAGTTATAAGTAGGGAAATGGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012238.3-1492s21c1
Sequence:CCGGGAGACTGTGATGTCATAATTACTCGAGTAATTATGACATCACAGTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_012238.3-645s1c1
Sequence:CCGGCCTCGAACAATTCTTAAAGATCTCGAGATCTTTAAGAATTGTTCGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_012238.3-1113s1c1
Sequence:CCGGGCGGGAATCCAAAGGATAATTCTCGAGAATTATCCTTTGGATTCCCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_012238.3-1958s1c1
Sequence:CCGGGCGGCTTGATGGTAATCAGTACTCGAGTACTGATTACCATCAAGCCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_012238.3-3206s1c1
Sequence:CCGGGCAAAGCCTTTCTGAATCTATCTCGAGATAGATTCAGAAAGGCTTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012238.3-497s1c1
Sequence:CCGGCGGTGATGAAATTATCACTAACTCGAGTTAGTGATAATTTCATCACCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_012238.3-872s21c1
Sequence:CCGGCAGGTCAAGGGATGGTATTTACTCGAGTAAATACCATCCCTTGACCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)