EMAIL THIS PAGE TO A FRIEND

SIRT7

sirtuin 7

50 Gene Product Result for
Synonyms: SIR2L7
UniProtKB ID: Q9NRC8, A8K2K0, B3KSU8, Q3MIK4, Q9NSZ6, Q9NUS6
Gene ID:
Human(51547) Summary: This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class IV of the sirtuin family. [provided by RefSeq, Jul 2008]
Mouse(209011) sirtuin 7
Rat(303745) sirtuin 7
cow(505662) sirtuin 7
sheep(101108066) sirtuin 7
fruit fly(43433) CG11305 gene product from transcript CG11305-RA
Zebrafish(654702) sirtuin 7
dog(483371) sirtuin 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016538 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016538 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016538 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153056 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153056 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153056 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016538 Rosetta Predictions human pricing
NM_001107073 Rosetta Predictions rat pricing
NM_153056 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133900 predicted 630
2 SASI_Hs01_00133901 predicted 1224
3 SASI_Hs01_00133902 predicted 972
4 SASI_Hs01_00133903 predicted 949
5 SASI_Hs01_00133904 predicted 805
6 SASI_Hs01_00133905 predicted 635
7 SASI_Hs01_00133906 predicted 1308
8 SASI_Hs01_00133907 predicted 476
9 SASI_Hs01_00133908 predicted 1473
10 SASI_Hs01_00133909 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225226 predicted 854
2 SASI_Rn02_00225227 predicted 313
3 SASI_Rn02_00225228 predicted 273
4 SASI_Rn02_00225229 predicted 1261
5 SASI_Rn02_00225230 predicted 852
6 SASI_Rn02_00225231 predicted 1380
7 SASI_Rn02_00225232 predicted 390
8 SASI_Rn02_00225233 predicted 812
9 SASI_Rn02_00225234 predicted 827
10 SASI_Rn02_00225235 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342865 predicted 635
2 SASI_Mm01_00064622 predicted 975
3 SASI_Mm01_00064628 predicted 1091
4 SASI_Mm01_00064630 predicted 1044
5 SASI_Mm02_00342866 predicted 824
6 SASI_Mm02_00342867 predicted 974
7 SASI_Mm02_00342868 predicted 397
8 SASI_Mm02_00342869 predicted 986
9 SASI_Mm02_00342870 predicted 1223
10 SASI_Mm02_00342871 predicted 349
11 SASI_Mm01_00064621 predicted 872
12 SASI_Mm01_00064623 predicted 801
13 SASI_Mm01_00064624 predicted 852
14 SASI_Mm01_00064625 predicted 693
15 SASI_Mm01_00064626 predicted 1449
16 SASI_Mm01_00064627 predicted 1203
17 SASI_Mm01_00064629 predicted 868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016538
VALIDATED
SIRT7 MISSION shRNA Bacterial Glycerol Stock
sirtuin 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016538.1-590s21c1
Sequence:CCGGTCCACGGGAACATGTACATTGCTCGAGCAATGTACATGTTCCCGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016538.1-837s21c1
Sequence:CCGGGTCCAGCCTGAAGGTTCTAAACTCGAGTTTAGAACCTTCAGGCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016538.1-1485s21c1
Sequence:CCGGAGAACGGAACTCGGGTTATTTCTCGAGAAATAACCCGAGTTCCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016538.1-842s1c1
Sequence:CCGGGCCTGAAGGTTCTAAAGAAGTCTCGAGACTTCTTTAGAACCTTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016538.1-730s1c1
Sequence:CCGGCGGGACACCATTGTGCACTTTCTCGAGAAAGTGCACAATGGTGTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016538.1-418s1c1
Sequence:CCGGCTTCAGAAAGGGAGAAGCGTTCTCGAGAACGCTTCTCCCTTTCTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016538.1-327s1c1
Sequence:CCGGCGCCAAATACTTGGTCGTCTACTCGAGTAGACGACCAAGTATTTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016538.1-1232s21c1
Sequence:CCGGCGTAATCACGTGCTCGATGAACTCGAGTTCATCGAGCACGTGATTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016538
VALIDATED
SIRT7 MISSION shRNA shRNA Plasmid DNA
sirtuin 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016538.1-590s21c1
Sequence:CCGGTCCACGGGAACATGTACATTGCTCGAGCAATGTACATGTTCCCGTGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000359663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016538.1-837s21c1
Sequence:CCGGGTCCAGCCTGAAGGTTCTAAACTCGAGTTTAGAACCTTCAGGCTGGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000359594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016538.1-1485s21c1
Sequence:CCGGAGAACGGAACTCGGGTTATTTCTCGAGAAATAACCCGAGTTCCGTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000020256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016538.1-842s1c1
Sequence:CCGGGCCTGAAGGTTCTAAAGAAGTCTCGAGACTTCTTTAGAACCTTCAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000020257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016538.1-730s1c1
Sequence:CCGGCGGGACACCATTGTGCACTTTCTCGAGAAAGTGCACAATGGTGTCCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000020258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016538.1-418s1c1
Sequence:CCGGCTTCAGAAAGGGAGAAGCGTTCTCGAGAACGCTTCTCCCTTTCTGAAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000020254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016538.1-327s1c1
Sequence:CCGGCGCCAAATACTTGGTCGTCTACTCGAGTAGACGACCAAGTATTTGGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000359592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016538.1-1232s21c1
Sequence:CCGGCGTAATCACGTGCTCGATGAACTCGAGTTCATCGAGCACGTGATTACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016538
VALIDATED
SIRT7 MISSION shRNA Lentiviral Transduction Particles
sirtuin 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016538.1-590s21c1
Sequence:CCGGTCCACGGGAACATGTACATTGCTCGAGCAATGTACATGTTCCCGTGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016538.1-837s21c1
Sequence:CCGGGTCCAGCCTGAAGGTTCTAAACTCGAGTTTAGAACCTTCAGGCTGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016538.1-1485s21c1
Sequence:CCGGAGAACGGAACTCGGGTTATTTCTCGAGAAATAACCCGAGTTCCGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016538.1-842s1c1
Sequence:CCGGGCCTGAAGGTTCTAAAGAAGTCTCGAGACTTCTTTAGAACCTTCAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016538.1-730s1c1
Sequence:CCGGCGGGACACCATTGTGCACTTTCTCGAGAAAGTGCACAATGGTGTCCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016538.1-418s1c1
Sequence:CCGGCTTCAGAAAGGGAGAAGCGTTCTCGAGAACGCTTCTCCCTTTCTGAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016538.1-327s1c1
Sequence:CCGGCGCCAAATACTTGGTCGTCTACTCGAGTAGACGACCAAGTATTTGGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016538.1-1232s21c1
Sequence:CCGGCGTAATCACGTGCTCGATGAACTCGAGTTCATCGAGCACGTGATTACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153056
VALIDATED
SIRT7 MISSION shRNA Bacterial Glycerol Stock
sirtuin 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153056.2-730s21c1
Sequence:CCGGCGGGATACCATTGTGCACTTTCTCGAGAAAGTGCACAATGGTATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153056.2-625s21c1
Sequence:CCGGTGCATCCCTAACAGAGAGTATCTCGAGATACTCTCTGTTAGGGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153056.2-1014s21c1
Sequence:CCGGCCTGGAGATTCCTGTCTACAACTCGAGTTGTAGACAGGAATCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153056.2-1581s21c1
Sequence:CCGGCCTCCCTCTTTCTACTCCTTACTCGAGTAAGGAGTAGAAAGAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153056.1-590s1c1
Sequence:CCGGTGCATCCCTAACAGAGAGTATCTCGAGATACTCTCTGTTAGGGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153056.1-979s1c1
Sequence:CCGGCCTGGAGATTCCTGTCTACAACTCGAGTTGTAGACAGGAATCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153056.2-1100s21c1
Sequence:CCGGGTAGGAAGTCACTATGCAGAACTCGAGTTCTGCATAGTGACTTCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153056.1-695s1c1
Sequence:CCGGCGGGATACCATTGTGCACTTTCTCGAGAAAGTGCACAATGGTATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153056.1-1065s1c1
Sequence:CCGGGTAGGAAGTCACTATGCAGAACTCGAGTTCTGCATAGTGACTTCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153056.1-1546s1c1
Sequence:CCGGCCTCCCTCTTTCTACTCCTTACTCGAGTAAGGAGTAGAAAGAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153056
VALIDATED
SIRT7 MISSION shRNA shRNA Plasmid DNA
sirtuin 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153056.2-730s21c1
Sequence:CCGGCGGGATACCATTGTGCACTTTCTCGAGAAAGTGCACAATGGTATCCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000302859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153056.2-625s21c1
Sequence:CCGGTGCATCCCTAACAGAGAGTATCTCGAGATACTCTCTGTTAGGGATGCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000302948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153056.2-1014s21c1
Sequence:CCGGCCTGGAGATTCCTGTCTACAACTCGAGTTGTAGACAGGAATCTCCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000302945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153056.2-1581s21c1
Sequence:CCGGCCTCCCTCTTTCTACTCCTTACTCGAGTAAGGAGTAGAAAGAGGGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000108948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153056.1-590s1c1
Sequence:CCGGTGCATCCCTAACAGAGAGTATCTCGAGATACTCTCTGTTAGGGATGCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000108946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153056.1-979s1c1
Sequence:CCGGCCTGGAGATTCCTGTCTACAACTCGAGTTGTAGACAGGAATCTCCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000302860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153056.2-1100s21c1
Sequence:CCGGGTAGGAAGTCACTATGCAGAACTCGAGTTCTGCATAGTGACTTCCTACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000108947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153056.1-695s1c1
Sequence:CCGGCGGGATACCATTGTGCACTTTCTCGAGAAAGTGCACAATGGTATCCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000108949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153056.1-1065s1c1
Sequence:CCGGGTAGGAAGTCACTATGCAGAACTCGAGTTCTGCATAGTGACTTCCTACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000108945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153056.1-1546s1c1
Sequence:CCGGCCTCCCTCTTTCTACTCCTTACTCGAGTAAGGAGTAGAAAGAGGGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153056
VALIDATED
SIRT7 MISSION shRNA Lentiviral Transduction Particles
sirtuin 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153056.2-730s21c1
Sequence:CCGGCGGGATACCATTGTGCACTTTCTCGAGAAAGTGCACAATGGTATCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153056.2-625s21c1
Sequence:CCGGTGCATCCCTAACAGAGAGTATCTCGAGATACTCTCTGTTAGGGATGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153056.2-1014s21c1
Sequence:CCGGCCTGGAGATTCCTGTCTACAACTCGAGTTGTAGACAGGAATCTCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153056.2-1581s21c1
Sequence:CCGGCCTCCCTCTTTCTACTCCTTACTCGAGTAAGGAGTAGAAAGAGGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153056.1-590s1c1
Sequence:CCGGTGCATCCCTAACAGAGAGTATCTCGAGATACTCTCTGTTAGGGATGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153056.1-979s1c1
Sequence:CCGGCCTGGAGATTCCTGTCTACAACTCGAGTTGTAGACAGGAATCTCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153056.2-1100s21c1
Sequence:CCGGGTAGGAAGTCACTATGCAGAACTCGAGTTCTGCATAGTGACTTCCTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153056.1-695s1c1
Sequence:CCGGCGGGATACCATTGTGCACTTTCTCGAGAAAGTGCACAATGGTATCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153056.1-1065s1c1
Sequence:CCGGGTAGGAAGTCACTATGCAGAACTCGAGTTCTGCATAGTGACTTCCTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153056.1-1546s1c1
Sequence:CCGGCCTCCCTCTTTCTACTCCTTACTCGAGTAAGGAGTAGAAAGAGGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)