EMAIL THIS PAGE TO A FRIEND

SIX1

SIX homeobox 1

62 Gene Product Result for
Synonyms: BOS3 DFNA23 TIP39
UniProtKB ID: Q15475, Q53Y16, Q96H64
Gene ID:
Human(6495) Summary: The protein encoded by this gene is a homeobox protein that is similar to the Drosophila 'sine oculis' gene product. This gene is found in a cluster of related genes on chromosome 14 and is thought to be involved in limb development. Defects in this gene are a cause of autosomal dominant deafness type 23 (DFNA23) and branchiootic syndrome type 3 (BOS3). [provided by RefSeq, Jul 2008]
Mouse(20471) sine oculis-related homeobox 1
Rat(114634) SIX homeobox 1
chicken(693262) SIX homeobox 1
domestic cat(101081144) SIX homeobox 1
dog(490719) SIX homeobox 1
cow(511371) SIX homeobox 1
sheep(100381248) SIX homeobox 1
naked mole-rat(101720008) SIX homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005982 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005982 Rosetta Predictions human pricing
XM_001080688 Rosetta Predictions rat pricing
XM_343079 Rosetta Predictions rat pricing
NM_009189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037155 predicted 932
2 SASI_Hs01_00037157 predicted 260
3 SASI_Hs01_00037158 predicted 566
4 SASI_Hs01_00037159 predicted 295
5 SASI_Hs01_00037160 predicted 830
6 SASI_Hs02_00340670 predicted 843
7 SASI_Hs01_00037161 predicted 935
8 SASI_Hs01_00037162 predicted 799
9 SASI_Hs01_00037163 predicted 832
10 SASI_Hs02_00340671 predicted 499
11 SASI_Hs01_00037154 predicted 1159
12 SASI_Hs01_00037156 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368940 predicted 878
2 SASI_Rn02_00368941 predicted 1326
3 SASI_Rn02_00368942 predicted 935
4 SASI_Rn02_00368943 predicted 1516
5 SASI_Rn02_00368944 predicted 1084
6 SASI_Rn02_00368945 predicted 1577
7 SASI_Rn02_00368946 predicted 1494
8 SASI_Rn02_00368947 predicted 1527
9 SASI_Rn02_00368948 predicted 1197
10 SASI_Rn02_00368949 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395271 predicted 878
2 SASI_Rn02_00395272 predicted 1325
3 SASI_Rn02_00395273 predicted 930
4 SASI_Rn02_00395274 predicted 1516
5 SASI_Rn02_00395275 predicted 1084
6 SASI_Rn02_00395276 predicted 1578
7 SASI_Rn02_00395277 predicted 1494
8 SASI_Rn02_00395278 predicted 1526
9 SASI_Rn02_00395279 predicted 1201
10 SASI_Rn02_00395280 predicted 1346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198104 predicted 301
2 SASI_Mm01_00198105 predicted 1097
3 SASI_Mm01_00198106 predicted 1161
4 SASI_Mm01_00198107 predicted 1014
5 SASI_Mm01_00198108 predicted 355
6 SASI_Mm01_00198109 predicted 972
7 SASI_Mm01_00198110 predicted 1371
8 SASI_Mm01_00198111 predicted 618
9 SASI_Mm01_00198112 predicted 1292
10 SASI_Mm01_00198113 predicted 1062
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009189
VALIDATED
SIX1 MISSION shRNA Bacterial Glycerol Stock
SIX homeobox 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009189.3-1508s21c1
Sequence:CCGGACAAATCAGCTGGATTGTAATCTCGAGATTACAATCCAGCTGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009189.3-474s21c1
Sequence:CCGGTCCGCGAGCTCTACAAGATACCTCGAGGTATCTTGTAGAGCTCGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009189.3-415s21c1
Sequence:CCGGGCACAAGAACGAGAGCGTGCTCTCGAGAGCACGCTCTCGTTCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009189.3-1005s21c1
Sequence:CCGGACGCCAGGAGCTCAAACTATTCTCGAGAATAGTTTGAGCTCCTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009189.3-541s21c1
Sequence:CCGGGCTGTGGCTGAAAGCGCACTACTCGAGTAGTGCGCTTTCAGCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009189.3-1439s21c1
Sequence:CCGGCTTTACAGTAGTCCCTTATTCCTCGAGGAATAAGGGACTACTGTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009189.1-296s1c1
Sequence:CCGGGCTGTGGCTGAAAGCGCACTACTCGAGTAGTGCGCTTTCAGCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009189.3-504s21c1
Sequence:CCGGACCAGTTCTCGCCTCACAATCCTCGAGGATTGTGAGGCGAGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009189.1-768s1c1
Sequence:CCGGAGCTCAAACTATTCTCTTCCACTCGAGTGGAAGAGAATAGTTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009189.1-629s1c1
Sequence:CCGGCTCCAACAAGCAGAATCAACTCTCGAGAGTTGATTCTGCTTGTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009189.1-170s1c1
Sequence:CCGGGCACAAGAACGAGAGCGTGCTCTCGAGAGCACGCTCTCGTTCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009189.1-740s1c1
Sequence:CCGGGCTCCAGAGCAATATGGGCCACTCGAGTGGCCCATATTGCTCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009189
VALIDATED
SIX1 MISSION shRNA shRNA Plasmid DNA
SIX homeobox 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009189.3-1508s21c1
Sequence:CCGGACAAATCAGCTGGATTGTAATCTCGAGATTACAATCCAGCTGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009189.3-474s21c1
Sequence:CCGGTCCGCGAGCTCTACAAGATACCTCGAGGTATCTTGTAGAGCTCGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009189.3-415s21c1
Sequence:CCGGGCACAAGAACGAGAGCGTGCTCTCGAGAGCACGCTCTCGTTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009189.3-1005s21c1
Sequence:CCGGACGCCAGGAGCTCAAACTATTCTCGAGAATAGTTTGAGCTCCTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009189.3-541s21c1
Sequence:CCGGGCTGTGGCTGAAAGCGCACTACTCGAGTAGTGCGCTTTCAGCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009189.3-1439s21c1
Sequence:CCGGCTTTACAGTAGTCCCTTATTCCTCGAGGAATAAGGGACTACTGTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009189.1-296s1c1
Sequence:CCGGGCTGTGGCTGAAAGCGCACTACTCGAGTAGTGCGCTTTCAGCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009189.3-504s21c1
Sequence:CCGGACCAGTTCTCGCCTCACAATCCTCGAGGATTGTGAGGCGAGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009189.1-768s1c1
Sequence:CCGGAGCTCAAACTATTCTCTTCCACTCGAGTGGAAGAGAATAGTTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009189.1-629s1c1
Sequence:CCGGCTCCAACAAGCAGAATCAACTCTCGAGAGTTGATTCTGCTTGTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009189.1-170s1c1
Sequence:CCGGGCACAAGAACGAGAGCGTGCTCTCGAGAGCACGCTCTCGTTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009189.1-740s1c1
Sequence:CCGGGCTCCAGAGCAATATGGGCCACTCGAGTGGCCCATATTGCTCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009189
VALIDATED
SIX1 MISSION shRNA Lentiviral Transduction Particles
SIX homeobox 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009189.3-1508s21c1
Sequence:CCGGACAAATCAGCTGGATTGTAATCTCGAGATTACAATCCAGCTGATTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009189.3-474s21c1
Sequence:CCGGTCCGCGAGCTCTACAAGATACCTCGAGGTATCTTGTAGAGCTCGCGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009189.3-415s21c1
Sequence:CCGGGCACAAGAACGAGAGCGTGCTCTCGAGAGCACGCTCTCGTTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009189.3-1005s21c1
Sequence:CCGGACGCCAGGAGCTCAAACTATTCTCGAGAATAGTTTGAGCTCCTGGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009189.3-541s21c1
Sequence:CCGGGCTGTGGCTGAAAGCGCACTACTCGAGTAGTGCGCTTTCAGCCACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009189.3-1439s21c1
Sequence:CCGGCTTTACAGTAGTCCCTTATTCCTCGAGGAATAAGGGACTACTGTAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009189.1-296s1c1
Sequence:CCGGGCTGTGGCTGAAAGCGCACTACTCGAGTAGTGCGCTTTCAGCCACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009189.3-504s21c1
Sequence:CCGGACCAGTTCTCGCCTCACAATCCTCGAGGATTGTGAGGCGAGAACTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009189.1-768s1c1
Sequence:CCGGAGCTCAAACTATTCTCTTCCACTCGAGTGGAAGAGAATAGTTTGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009189.1-629s1c1
Sequence:CCGGCTCCAACAAGCAGAATCAACTCTCGAGAGTTGATTCTGCTTGTTGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009189.1-170s1c1
Sequence:CCGGGCACAAGAACGAGAGCGTGCTCTCGAGAGCACGCTCTCGTTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009189.1-740s1c1
Sequence:CCGGGCTCCAGAGCAATATGGGCCACTCGAGTGGCCCATATTGCTCTGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005982
SIX1 MISSION shRNA Bacterial Glycerol Stock
SIX homeobox 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005982.3-1198s21c1
Sequence:CCGGAGCTTGTTTCTGGAGTTGTTTCTCGAGAAACAACTCCAGAAACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005982.3-380s21c1
Sequence:CCGGCAAGAACGAGAGCGTACTCAACTCGAGTTGAGTACGCTCTCGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005982.3-967s21c1
Sequence:CCGGACGCCAGGAGCTCAAACTATTCTCGAGAATAGTTTGAGCTCCTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005982.3-824s21c1
Sequence:CCGGCAATAACTCCTCCTCCAACAACTCGAGTTGTTGGAGGAGGAGTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005982.1-407s1c1
Sequence:CCGGCAAGAACGAGAGCGTACTCAACTCGAGTTGAGTACGCTCTCGTTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005982.1-992s1c1
Sequence:CCGGCCACGCCAGGAGCTCAAACTACTCGAGTAGTTTGAGCTCCTGGCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005982.1-951s1c1
Sequence:CCGGCCAGACCAGAACTCGGTCCTTCTCGAGAAGGACCGAGTTCTGGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005982.1-851s1c1
Sequence:CCGGCAATAACTCCTCCTCCAACAACTCGAGTTGTTGGAGGAGGAGTTATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005982.1-1225s1c1
Sequence:CCGGAGCTTGTTTCTGGAGTTGTTTCTCGAGAAACAACTCCAGAAACAAGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005982
SIX1 MISSION shRNA shRNA Plasmid DNA
SIX homeobox 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005982.3-1198s21c1
Sequence:CCGGAGCTTGTTTCTGGAGTTGTTTCTCGAGAAACAACTCCAGAAACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005982.3-380s21c1
Sequence:CCGGCAAGAACGAGAGCGTACTCAACTCGAGTTGAGTACGCTCTCGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005982.3-967s21c1
Sequence:CCGGACGCCAGGAGCTCAAACTATTCTCGAGAATAGTTTGAGCTCCTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005982.3-824s21c1
Sequence:CCGGCAATAACTCCTCCTCCAACAACTCGAGTTGTTGGAGGAGGAGTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005982.1-407s1c1
Sequence:CCGGCAAGAACGAGAGCGTACTCAACTCGAGTTGAGTACGCTCTCGTTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005982.1-992s1c1
Sequence:CCGGCCACGCCAGGAGCTCAAACTACTCGAGTAGTTTGAGCTCCTGGCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005982.1-951s1c1
Sequence:CCGGCCAGACCAGAACTCGGTCCTTCTCGAGAAGGACCGAGTTCTGGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005982.1-851s1c1
Sequence:CCGGCAATAACTCCTCCTCCAACAACTCGAGTTGTTGGAGGAGGAGTTATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005982.1-1225s1c1
Sequence:CCGGAGCTTGTTTCTGGAGTTGTTTCTCGAGAAACAACTCCAGAAACAAGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005982
SIX1 MISSION shRNA Lentiviral Transduction Particles
SIX homeobox 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005982.3-1198s21c1
Sequence:CCGGAGCTTGTTTCTGGAGTTGTTTCTCGAGAAACAACTCCAGAAACAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005982.3-380s21c1
Sequence:CCGGCAAGAACGAGAGCGTACTCAACTCGAGTTGAGTACGCTCTCGTTCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005982.3-967s21c1
Sequence:CCGGACGCCAGGAGCTCAAACTATTCTCGAGAATAGTTTGAGCTCCTGGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005982.3-824s21c1
Sequence:CCGGCAATAACTCCTCCTCCAACAACTCGAGTTGTTGGAGGAGGAGTTATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005982.1-407s1c1
Sequence:CCGGCAAGAACGAGAGCGTACTCAACTCGAGTTGAGTACGCTCTCGTTCTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005982.1-992s1c1
Sequence:CCGGCCACGCCAGGAGCTCAAACTACTCGAGTAGTTTGAGCTCCTGGCGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005982.1-951s1c1
Sequence:CCGGCCAGACCAGAACTCGGTCCTTCTCGAGAAGGACCGAGTTCTGGTCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005982.1-851s1c1
Sequence:CCGGCAATAACTCCTCCTCCAACAACTCGAGTTGTTGGAGGAGGAGTTATTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005982.1-1225s1c1
Sequence:CCGGAGCTTGTTTCTGGAGTTGTTTCTCGAGAAACAACTCCAGAAACAAGCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)