EMAIL THIS PAGE TO A FRIEND

SIX6

SIX homeobox 6

58 Gene Product Result for
Synonyms: MCOPCT2 OPTX2 Six9
UniProtKB ID: O95475, Q6NT42, Q9P1X8
Gene ID:
Human(4990) Summary: The protein encoded by this gene is a homeobox protein that is similar to the Drosophila 'sine oculis' gene product. This gene is found in a cluster of related genes on chromosome 14 and is thought to be involved in eye development. Defects in this gene are a cause of isolated microphthalmia with cataract type 2 (MCOPCT2). [provided by RefSeq, Jul 2008]
Mouse(20476) sine oculis-related homeobox 6
Rat(314221) SIX homeobox 6
cow(539749) SIX homeobox 6
sheep(100302061) SIX homeobox 6
naked mole-rat(101720350) SIX homeobox 6
chicken(395843) SIX homeobox 6
domestic cat(101080641) SIX homeobox 6
dog(490718) SIX homeobox 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA001403 Anti-SIX6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502049 Anti-SIX6 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007374 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155651 MISSION® esiRNA esiRNA human SIX6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007374 Rosetta Predictions human pricing
NM_001108032 Rosetta Predictions rat pricing
NM_011384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015777 predicted 866
2 SASI_Hs01_00015778 predicted 384
3 SASI_Hs01_00015780 predicted 543
4 SASI_Hs01_00015781 predicted 386
5 SASI_Hs01_00015782 predicted 863
6 SASI_Hs01_00015783 predicted 466
7 SASI_Hs02_00343507 predicted 994
8 SASI_Hs01_00015785 predicted 413
9 SASI_Hs01_00015786 predicted 902
10 SASI_Hs02_00343508 predicted 504
11 SASI_Hs01_00015779 predicted 862
12 SASI_Hs01_00015784 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234695 predicted 917
2 SASI_Rn02_00234696 predicted 362
3 SASI_Rn02_00234697 predicted 922
4 SASI_Rn02_00234698 predicted 732
5 SASI_Rn02_00234699 predicted 888
6 SASI_Rn02_00234700 predicted 896
7 SASI_Rn02_00234701 predicted 598
8 SASI_Rn02_00234702 predicted 893
9 SASI_Rn02_00234703 predicted 905
10 SASI_Rn02_00234704 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045023 predicted 1122
2 SASI_Mm01_00045024 predicted 536
3 SASI_Mm01_00045025 predicted 1322
4 SASI_Mm01_00045027 predicted 300
5 SASI_Mm01_00045028 predicted 230
6 SASI_Mm01_00045029 predicted 613
7 SASI_Mm01_00045030 predicted 389
8 SASI_Mm01_00045031 predicted 227
9 SASI_Mm01_00045032 predicted 429
10 SASI_Mm02_00320570 predicted 1141
11 SASI_Mm01_00045026 predicted 1162
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007374
VALIDATED
SIX6 MISSION shRNA Bacterial Glycerol Stock
SIX homeobox 6
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-872s21c1
Sequence:CCGGCACTTCAGCCATCTCCATCACCTCGAGGTGATGGAGATGGCTGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007374.1-1159s1c1
Sequence:CCGGCATGGGTATTTCACGTCGAAACTCGAGTTTCGACGTGAAATACCCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007374.1-420s1c1
Sequence:CCGGCCTGTGGACAAGTACCGAGTACTCGAGTACTCGGTACTTGTCCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007374.1-233s1c1
Sequence:CCGGCCTCAACAAGAATGAGTCGGTCTCGAGACCGACTCATTCTTGTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_007374.1-301s1c1
Sequence:CCGGAGCTCTATCATATCCTGGAAACTCGAGTTTCCAGGATATGATAGAGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_007374.1-536s1c1
Sequence:CCGGCCTGCAGGATCCATACCCTAACTCGAGTTAGGGTATGGATCCTGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-452s21c1
Sequence:CCGGGCTTGAAGCACACTACCAGGACTCGAGTCCTGGTAGTGTGCTTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007374.2-932s21c1
Sequence:CCGGAGGATGCTCAGAAGCAGATTCCTCGAGGAATCTGCTTCTGAGCATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-566s21c1
Sequence:CCGGACAGAAGACACACTGCTTCAACTCGAGTTGAAGCAGTGTGTCTTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-361s21c1
Sequence:CCGGCCTTTCACGGTGGCAACTACCCTCGAGGGTAGTTGCCACCGTGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-551s21c1
Sequence:CCGGCATTTGGGACGGCGAACAGAACTCGAGTTCTGTTCGCCGTCCCAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-909s21c1
Sequence:CCGGTGCGACATCTGAGTTGCCCATCTCGAGATGGGCAACTCAGATGTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-474s21c1
Sequence:CCGGGCTGAGAAGCTGCGTGGAAGACTCGAGTCTTCCACGCAGCTTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007374
VALIDATED
SIX6 MISSION shRNA shRNA Plasmid DNA
SIX homeobox 6
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-872s21c1
Sequence:CCGGCACTTCAGCCATCTCCATCACCTCGAGGTGATGGAGATGGCTGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007374.1-1159s1c1
Sequence:CCGGCATGGGTATTTCACGTCGAAACTCGAGTTTCGACGTGAAATACCCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007374.1-420s1c1
Sequence:CCGGCCTGTGGACAAGTACCGAGTACTCGAGTACTCGGTACTTGTCCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007374.1-233s1c1
Sequence:CCGGCCTCAACAAGAATGAGTCGGTCTCGAGACCGACTCATTCTTGTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_007374.1-301s1c1
Sequence:CCGGAGCTCTATCATATCCTGGAAACTCGAGTTTCCAGGATATGATAGAGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_007374.1-536s1c1
Sequence:CCGGCCTGCAGGATCCATACCCTAACTCGAGTTAGGGTATGGATCCTGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-452s21c1
Sequence:CCGGGCTTGAAGCACACTACCAGGACTCGAGTCCTGGTAGTGTGCTTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007374.2-932s21c1
Sequence:CCGGAGGATGCTCAGAAGCAGATTCCTCGAGGAATCTGCTTCTGAGCATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-566s21c1
Sequence:CCGGACAGAAGACACACTGCTTCAACTCGAGTTGAAGCAGTGTGTCTTCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-361s21c1
Sequence:CCGGCCTTTCACGGTGGCAACTACCCTCGAGGGTAGTTGCCACCGTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-551s21c1
Sequence:CCGGCATTTGGGACGGCGAACAGAACTCGAGTTCTGTTCGCCGTCCCAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-909s21c1
Sequence:CCGGTGCGACATCTGAGTTGCCCATCTCGAGATGGGCAACTCAGATGTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-474s21c1
Sequence:CCGGGCTGAGAAGCTGCGTGGAAGACTCGAGTCTTCCACGCAGCTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007374
VALIDATED
SIX6 MISSION shRNA Lentiviral Transduction Particles
SIX homeobox 6
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-872s21c1
Sequence:CCGGCACTTCAGCCATCTCCATCACCTCGAGGTGATGGAGATGGCTGAAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007374.1-1159s1c1
Sequence:CCGGCATGGGTATTTCACGTCGAAACTCGAGTTTCGACGTGAAATACCCATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007374.1-420s1c1
Sequence:CCGGCCTGTGGACAAGTACCGAGTACTCGAGTACTCGGTACTTGTCCACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007374.1-233s1c1
Sequence:CCGGCCTCAACAAGAATGAGTCGGTCTCGAGACCGACTCATTCTTGTTGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_007374.1-301s1c1
Sequence:CCGGAGCTCTATCATATCCTGGAAACTCGAGTTTCCAGGATATGATAGAGCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_007374.1-536s1c1
Sequence:CCGGCCTGCAGGATCCATACCCTAACTCGAGTTAGGGTATGGATCCTGCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-452s21c1
Sequence:CCGGGCTTGAAGCACACTACCAGGACTCGAGTCCTGGTAGTGTGCTTCAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007374.2-932s21c1
Sequence:CCGGAGGATGCTCAGAAGCAGATTCCTCGAGGAATCTGCTTCTGAGCATCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-566s21c1
Sequence:CCGGACAGAAGACACACTGCTTCAACTCGAGTTGAAGCAGTGTGTCTTCTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-361s21c1
Sequence:CCGGCCTTTCACGGTGGCAACTACCCTCGAGGGTAGTTGCCACCGTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-551s21c1
Sequence:CCGGCATTTGGGACGGCGAACAGAACTCGAGTTCTGTTCGCCGTCCCAAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-909s21c1
Sequence:CCGGTGCGACATCTGAGTTGCCCATCTCGAGATGGGCAACTCAGATGTCGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007374.2-474s21c1
Sequence:CCGGGCTGAGAAGCTGCGTGGAAGACTCGAGTCTTCCACGCAGCTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011384
SIX6 MISSION shRNA Bacterial Glycerol Stock
SIX homeobox 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-548s1c1
Sequence:CCGGTGGTACCTTCAGGACCCATATCTCGAGATATGGGTCCTGAAGGTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-496s1c1
Sequence:CCGGCGAACAGAAGACTCACTGCTTCTCGAGAAGCAGTGAGTCTTCTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-317s1c1
Sequence:CCGGGAGCTTTATCATATCCTGGAACTCGAGTTCCAGGATATGATAAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-250s1c1
Sequence:CCGGCCTTAACAAGAATGAGTCGGTCTCGAGACCGACTCATTCTTGTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-437s1c1
Sequence:CCGGCCAGTAGACAAGTACCGAGTACTCGAGTACTCGGTACTTGTCTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011384
SIX6 MISSION shRNA shRNA Plasmid DNA
SIX homeobox 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-548s1c1
Sequence:CCGGTGGTACCTTCAGGACCCATATCTCGAGATATGGGTCCTGAAGGTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-496s1c1
Sequence:CCGGCGAACAGAAGACTCACTGCTTCTCGAGAAGCAGTGAGTCTTCTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-317s1c1
Sequence:CCGGGAGCTTTATCATATCCTGGAACTCGAGTTCCAGGATATGATAAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-250s1c1
Sequence:CCGGCCTTAACAAGAATGAGTCGGTCTCGAGACCGACTCATTCTTGTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-437s1c1
Sequence:CCGGCCAGTAGACAAGTACCGAGTACTCGAGTACTCGGTACTTGTCTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011384
SIX6 MISSION shRNA Lentiviral Transduction Particles
SIX homeobox 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-548s1c1
Sequence:CCGGTGGTACCTTCAGGACCCATATCTCGAGATATGGGTCCTGAAGGTACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-496s1c1
Sequence:CCGGCGAACAGAAGACTCACTGCTTCTCGAGAAGCAGTGAGTCTTCTGTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-317s1c1
Sequence:CCGGGAGCTTTATCATATCCTGGAACTCGAGTTCCAGGATATGATAAAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-250s1c1
Sequence:CCGGCCTTAACAAGAATGAGTCGGTCTCGAGACCGACTCATTCTTGTTAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011384.2-437s1c1
Sequence:CCGGCCAGTAGACAAGTACCGAGTACTCGAGTACTCGGTACTTGTCTACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)