EMAIL THIS PAGE TO A FRIEND

SKA2

spindle and kinetochore associated complex subunit 2

90 Gene Product Result for
Synonyms: FAM33A
UniProtKB ID: Q8WVK7, A6NIL3, B3KPL3, E9PCB8
Gene ID:
Mouse(66140) spindle and kinetochore associated complex subunit 2
Rat(287598) spindle and kinetochore associated complex subunit 2
naked mole-rat(101716384) spindle and kinetochore associated complex subunit 2
cow(615847) spindle and kinetochore associated complex subunit 2
sheep(101103247) spindle and kinetochore associated complex subunit 2
chicken(417629) spindle and kinetochore associated complex subunit 2
domestic cat(101095141) spindle and kinetochore associated complex subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182620 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100595 Rosetta Predictions human pricing
NM_182620 Rosetta Predictions human pricing
NM_001009624 Rosetta Predictions rat pricing
NM_025377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322194 predicted 887
2 SASI_Hs02_00322195 predicted 1018
3 SASI_Hs02_00322196 predicted 910
4 SASI_Hs02_00322197 predicted 903
5 SASI_Hs02_00322198 predicted 1063
6 SASI_Hs02_00322199 predicted 775
7 SASI_Hs02_00322200 predicted 1009
8 SASI_Hs02_00322201 predicted 1061
9 SASI_Hs02_00322202 predicted 1023
10 SASI_Hs02_00322203 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370759 predicted 884
2 SASI_Hs01_00077448 predicted 1020
3 SASI_Hs01_00077449 predicted 911
4 SASI_Hs01_00077453 predicted 900
5 SASI_Hs02_00370760 predicted 1109
6 SASI_Hs02_00370761 predicted 1059
7 SASI_Hs02_00370762 predicted 777
8 SASI_Hs02_00370763 predicted 1011
9 SASI_Hs02_00370764 predicted 1104
10 SASI_Hs02_00370765 predicted 1065
11 SASI_Hs01_00077450 predicted 797
12 SASI_Hs01_00077451 predicted 378
13 SASI_Hs01_00077452 predicted 235
14 SASI_Hs01_00077454 predicted 625
15 SASI_Hs01_00077455 predicted 370
16 SASI_Hs01_00077456 predicted 258
17 SASI_Hs01_00077457 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114370 predicted 907
2 SASI_Rn01_00114376 predicted 358
3 SASI_Rn01_00114371 predicted 222
4 SASI_Rn01_00114373 predicted 905
5 SASI_Rn01_00114377 predicted 334
6 SASI_Rn02_00199629 predicted 307
7 SASI_Rn01_00114378 predicted 194
8 SASI_Rn01_00114372 predicted 908
9 SASI_Rn02_00199630 predicted 743
10 SASI_Rn01_00114369 predicted 259
11 SASI_Rn01_00114374 predicted 914
12 SASI_Rn01_00114375 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101446 predicted 301
2 SASI_Mm01_00101447 predicted 355
3 SASI_Mm01_00101448 predicted 327
4 SASI_Mm01_00101449 predicted 227
5 SASI_Mm02_00328107 predicted 263
6 SASI_Mm01_00101450 predicted 302
7 SASI_Mm01_00101451 predicted 328
8 SASI_Mm01_00101453 predicted 305
9 SASI_Mm01_00101454 predicted 231
10 SASI_Mm01_00101455 predicted 358
11 SASI_Mm01_00101452 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025377
VALIDATED
SKA2 MISSION shRNA Bacterial Glycerol Stock
spindle and kinetochore associated complex subunit 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-480s21c1
Sequence:CCGGCGAGAGGATCGTGATGCATTTCTCGAGAAATGCATCACGATCCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025377.3-186s1c1
Sequence:CCGGGCTTTATGTGCACGCTTTAAGCTCGAGCTTAAAGCGTGCACATAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-581s21c1
Sequence:CCGGACTGATACCCAGCATTCATTTCTCGAGAAATGAATGCTGGGTATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-1049s21c1
Sequence:CCGGCCACATCCCAACCCTGTATTTCTCGAGAAATACAGGGTTGGGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025377.3-90s1c1
Sequence:CCGGGAATATGAAGTCAAGACTAATCTCGAGATTAGTCTTGACTTCATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025377.3-63s1c1
Sequence:CCGGGATTTGGATTACCTTCAATATCTCGAGATATTGAAGGTAATCCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025377.1-248s1c1
Sequence:CCGGGTGCTACTTTGAACAAGACAACTCGAGTTGTCTTGTTCAAAGTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-938s21c1
Sequence:CCGGTTGGTGTCAATAGGGATAATACTCGAGTATTATCCCTATTGACACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-654s21c1
Sequence:CCGGTTGTATAGTGTTGGCATAATTCTCGAGAATTATGCCAACACTATACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025377
VALIDATED
SKA2 MISSION shRNA shRNA Plasmid DNA
spindle and kinetochore associated complex subunit 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-480s21c1
Sequence:CCGGCGAGAGGATCGTGATGCATTTCTCGAGAAATGCATCACGATCCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025377.3-186s1c1
Sequence:CCGGGCTTTATGTGCACGCTTTAAGCTCGAGCTTAAAGCGTGCACATAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-581s21c1
Sequence:CCGGACTGATACCCAGCATTCATTTCTCGAGAAATGAATGCTGGGTATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-1049s21c1
Sequence:CCGGCCACATCCCAACCCTGTATTTCTCGAGAAATACAGGGTTGGGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025377.3-90s1c1
Sequence:CCGGGAATATGAAGTCAAGACTAATCTCGAGATTAGTCTTGACTTCATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025377.3-63s1c1
Sequence:CCGGGATTTGGATTACCTTCAATATCTCGAGATATTGAAGGTAATCCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025377.1-248s1c1
Sequence:CCGGGTGCTACTTTGAACAAGACAACTCGAGTTGTCTTGTTCAAAGTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-938s21c1
Sequence:CCGGTTGGTGTCAATAGGGATAATACTCGAGTATTATCCCTATTGACACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-654s21c1
Sequence:CCGGTTGTATAGTGTTGGCATAATTCTCGAGAATTATGCCAACACTATACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025377
VALIDATED
SKA2 MISSION shRNA Lentiviral Transduction Particles
spindle and kinetochore associated complex subunit 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-480s21c1
Sequence:CCGGCGAGAGGATCGTGATGCATTTCTCGAGAAATGCATCACGATCCTCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025377.3-186s1c1
Sequence:CCGGGCTTTATGTGCACGCTTTAAGCTCGAGCTTAAAGCGTGCACATAAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-581s21c1
Sequence:CCGGACTGATACCCAGCATTCATTTCTCGAGAAATGAATGCTGGGTATCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-1049s21c1
Sequence:CCGGCCACATCCCAACCCTGTATTTCTCGAGAAATACAGGGTTGGGATGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025377.3-90s1c1
Sequence:CCGGGAATATGAAGTCAAGACTAATCTCGAGATTAGTCTTGACTTCATATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000215743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025377.3-63s1c1
Sequence:CCGGGATTTGGATTACCTTCAATATCTCGAGATATTGAAGGTAATCCAAATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000179681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025377.1-248s1c1
Sequence:CCGGGTGCTACTTTGAACAAGACAACTCGAGTTGTCTTGTTCAAAGTAGCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-938s21c1
Sequence:CCGGTTGGTGTCAATAGGGATAATACTCGAGTATTATCCCTATTGACACCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025377.3-654s21c1
Sequence:CCGGTTGTATAGTGTTGGCATAATTCTCGAGAATTATGCCAACACTATACAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182620
SKA2 MISSION shRNA Bacterial Glycerol Stock
spindle and kinetochore associated complex subunit 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182620.1-681s1c1
Sequence:CCGGCCAGAAATTCTCAACACTATTCTCGAGAATAGTGTTGAGAATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182620.1-83s1c1
Sequence:CCGGGAGTCTGATCTGGATTACATTCTCGAGAATGTAATCCAGATCAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182620.1-209s1c1
Sequence:CCGGCAAACTTTGTATGCCCGCTTTCTCGAGAAAGCGGGCATACAAAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182620.1-186s1c1
Sequence:CCGGTGTCAGTGATAAAGTCTCGATCTCGAGATCGAGACTTTATCACTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182620.1-365s1c1
Sequence:CCGGGCGGCAGAGCAATTCAAATTTCTCGAGAAATTTGAATTGCTCTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182620
SKA2 MISSION shRNA shRNA Plasmid DNA
spindle and kinetochore associated complex subunit 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182620.1-681s1c1
Sequence:CCGGCCAGAAATTCTCAACACTATTCTCGAGAATAGTGTTGAGAATTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182620.1-83s1c1
Sequence:CCGGGAGTCTGATCTGGATTACATTCTCGAGAATGTAATCCAGATCAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182620.1-209s1c1
Sequence:CCGGCAAACTTTGTATGCCCGCTTTCTCGAGAAAGCGGGCATACAAAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182620.1-186s1c1
Sequence:CCGGTGTCAGTGATAAAGTCTCGATCTCGAGATCGAGACTTTATCACTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182620.1-365s1c1
Sequence:CCGGGCGGCAGAGCAATTCAAATTTCTCGAGAAATTTGAATTGCTCTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182620
SKA2 MISSION shRNA Lentiviral Transduction Particles
spindle and kinetochore associated complex subunit 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182620.1-681s1c1
Sequence:CCGGCCAGAAATTCTCAACACTATTCTCGAGAATAGTGTTGAGAATTTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182620.1-83s1c1
Sequence:CCGGGAGTCTGATCTGGATTACATTCTCGAGAATGTAATCCAGATCAGACTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182620.1-209s1c1
Sequence:CCGGCAAACTTTGTATGCCCGCTTTCTCGAGAAAGCGGGCATACAAAGTTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182620.1-186s1c1
Sequence:CCGGTGTCAGTGATAAAGTCTCGATCTCGAGATCGAGACTTTATCACTGACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182620.1-365s1c1
Sequence:CCGGGCGGCAGAGCAATTCAAATTTCTCGAGAAATTTGAATTGCTCTGCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???