EMAIL THIS PAGE TO A FRIEND

SKI

v-ski avian sarcoma viral oncogene homolog

95 Gene Product Result for
Synonyms: SGS SKV
UniProtKB ID: P12755, Q5SYT7
Gene ID:
Human(6497) Summary: This gene encodes the nuclear protooncogene protein homolog of avian sarcoma viral (v-ski) oncogene. It functions as a repressor of TGF-beta signaling, and may play a role in neural tube development and muscle differentiation. [provided by RefSeq, Oct 2009]
Mouse(20481) ski sarcoma viral oncogene homolog (avian)
Rat(313757) v-ski avian sarcoma viral oncogene homolog
chicken(428181) v-ski sarcoma viral oncogene homolog
dog(489610) v-ski sarcoma viral oncogene homolog (avian)
domestic cat(101088346) v-ski sarcoma viral oncogene homolog (avian)
naked mole-rat(101697328) v-ski sarcoma viral oncogene homolog (avian)
domestic guinea pig(100734391) v-ski sarcoma viral oncogene homolog (avian)
cow(506127) v-ski sarcoma viral oncogene homolog (avian)
sheep(101121791) v-ski sarcoma viral oncogene homolog (avian)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003036 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003036 Rosetta Predictions human pricing
XM_001077382 Rosetta Predictions rat pricing
XM_233731 Rosetta Predictions rat pricing
NM_011385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223663 predicted 820
2 SASI_Hs01_00223664 predicted 1964
3 SASI_Hs01_00223665 predicted 2519
4 SASI_Hs01_00223666 predicted 1219
5 SASI_Hs01_00223667 predicted 2361
6 SASI_Hs01_00223668 predicted 463
7 SASI_Hs01_00223670 predicted 1897
8 SASI_Hs01_00223671 predicted 2052
9 SASI_Hs01_00223672 predicted 1530
10 SASI_Hs02_00334944 predicted 2045
11 SASI_Hs01_00223669 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077382 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356850 predicted 1958
2 SASI_Rn02_00356851 predicted 1009
3 SASI_Rn02_00356852 predicted 923
4 SASI_Rn02_00356853 predicted 1626
5 SASI_Rn02_00356854 predicted 1447
6 SASI_Rn02_00356855 predicted 1619
7 SASI_Rn02_00356856 predicted 1629
8 SASI_Rn02_00356857 predicted 1091
9 SASI_Rn02_00356858 predicted 1098
10 SASI_Rn02_00356859 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388000 predicted 711
2 SASI_Rn02_00388001 predicted 697
3 SASI_Rn02_00388002 predicted 764
4 SASI_Rn02_00388003 predicted 708
5 SASI_Rn02_00388004 predicted 662
6 SASI_Rn02_00388005 predicted 766
7 SASI_Rn02_00388006 predicted 767
8 SASI_Rn02_00388007 predicted 654
9 SASI_Rn02_00388008 predicted 663
10 SASI_Rn02_00388009 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320571 predicted 1809
2 SASI_Mm02_00320572 predicted 1452
3 SASI_Mm02_00320573 predicted 2462
4 SASI_Mm01_00090896 predicted 858
5 SASI_Mm01_00090898 predicted 761
6 SASI_Mm01_00090900 predicted 1473
7 SASI_Mm01_00090904 predicted 1339
8 SASI_Mm02_00320574 predicted 1987
9 SASI_Mm02_00320575 predicted 1667
10 SASI_Mm02_00320576 predicted 932
11 SASI_Mm01_00090897 predicted 1146
12 SASI_Mm01_00090899 predicted 1047
13 SASI_Mm01_00090901 predicted 1193
14 SASI_Mm01_00090902 predicted 1815
15 SASI_Mm01_00090903 predicted 291
16 SASI_Mm01_00090905 predicted 289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003036
VALIDATED
SKI MISSION shRNA Bacterial Glycerol Stock
v-ski avian sarcoma viral oncogene homolog
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003036.x-2634s1c1
Sequence:CCGGCACATGACGCCATCTGAAGACCTCGAGGTCTTCAGATGGCGTCATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.33 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003036.1-991s1c1
Sequence:CCGGGTGAAGGAGAAATTCGACTATCTCGAGATAGTCGAATTTCTCCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003036.x-3486s1c1
Sequence:CCGGAATCTGCCACTCTCAGAATACTCGAGTATTCTGAGAGTGGCAGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003036.x-2070s1c1
Sequence:CCGGATCGAAGACCTGCAGGTGAACTCGAGTTCACCTGCAGGTCTTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003036.1-543s1c1
Sequence:CCGGGCTGGAGATCCTCAAAGTCATCTCGAGATGACTTTGAGGATCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003036.1-3286s1c1
Sequence:CCGGCCGACTTTATAGAGCAGTCAACTCGAGTTGACTGCTCTATAAAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.36 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003036.1-1744s1c1
Sequence:CCGGGCCAAAGAGAAGTTCCTGCATCTCGAGATGCAGGAACTTCTCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003036.2-2364s21c1
Sequence:CCGGACGTCTTACCGTGCCTATTACCTCGAGGTAATAGGCACGGTAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003036.2-737s21c1
Sequence:CCGGACGAGTGCTTCGGCAAGTGTACTCGAGTACACTTGCCGAAGCACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003036.2-992s21c1
Sequence:CCGGTGAAGGAGAAATTCGACTATGCTCGAGCATAGTCGAATTTCTCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003036.2-1226s21c1
Sequence:CCGGCAGTGTCAGCGAGTGAGAAAGCTCGAGCTTTCTCACTCGCTGACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003036.2-1758s21c1
Sequence:CCGGCCTGCATGAGGTGGTCAAGATCTCGAGATCTTGACCACCTCATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003036
VALIDATED
SKI MISSION shRNA shRNA Plasmid DNA
v-ski avian sarcoma viral oncogene homolog
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003036.x-2634s1c1
Sequence:CCGGCACATGACGCCATCTGAAGACCTCGAGGTCTTCAGATGGCGTCATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.33 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003036.1-991s1c1
Sequence:CCGGGTGAAGGAGAAATTCGACTATCTCGAGATAGTCGAATTTCTCCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003036.x-3486s1c1
Sequence:CCGGAATCTGCCACTCTCAGAATACTCGAGTATTCTGAGAGTGGCAGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003036.x-2070s1c1
Sequence:CCGGATCGAAGACCTGCAGGTGAACTCGAGTTCACCTGCAGGTCTTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003036.1-543s1c1
Sequence:CCGGGCTGGAGATCCTCAAAGTCATCTCGAGATGACTTTGAGGATCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003036.1-3286s1c1
Sequence:CCGGCCGACTTTATAGAGCAGTCAACTCGAGTTGACTGCTCTATAAAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.36 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003036.1-1744s1c1
Sequence:CCGGGCCAAAGAGAAGTTCCTGCATCTCGAGATGCAGGAACTTCTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003036.2-2364s21c1
Sequence:CCGGACGTCTTACCGTGCCTATTACCTCGAGGTAATAGGCACGGTAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003036.2-737s21c1
Sequence:CCGGACGAGTGCTTCGGCAAGTGTACTCGAGTACACTTGCCGAAGCACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003036.2-992s21c1
Sequence:CCGGTGAAGGAGAAATTCGACTATGCTCGAGCATAGTCGAATTTCTCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003036.2-1226s21c1
Sequence:CCGGCAGTGTCAGCGAGTGAGAAAGCTCGAGCTTTCTCACTCGCTGACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003036.2-1758s21c1
Sequence:CCGGCCTGCATGAGGTGGTCAAGATCTCGAGATCTTGACCACCTCATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003036
VALIDATED
SKI MISSION shRNA Lentiviral Transduction Particles
v-ski avian sarcoma viral oncogene homolog
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003036.x-2634s1c1
Sequence:CCGGCACATGACGCCATCTGAAGACCTCGAGGTCTTCAGATGGCGTCATGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.33 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003036.1-991s1c1
Sequence:CCGGGTGAAGGAGAAATTCGACTATCTCGAGATAGTCGAATTTCTCCTTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003036.x-3486s1c1
Sequence:CCGGAATCTGCCACTCTCAGAATACTCGAGTATTCTGAGAGTGGCAGATTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003036.x-2070s1c1
Sequence:CCGGATCGAAGACCTGCAGGTGAACTCGAGTTCACCTGCAGGTCTTCGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003036.1-543s1c1
Sequence:CCGGGCTGGAGATCCTCAAAGTCATCTCGAGATGACTTTGAGGATCTCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003036.1-3286s1c1
Sequence:CCGGCCGACTTTATAGAGCAGTCAACTCGAGTTGACTGCTCTATAAAGTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.36 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003036.1-1744s1c1
Sequence:CCGGGCCAAAGAGAAGTTCCTGCATCTCGAGATGCAGGAACTTCTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003036.2-2364s21c1
Sequence:CCGGACGTCTTACCGTGCCTATTACCTCGAGGTAATAGGCACGGTAAGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003036.2-737s21c1
Sequence:CCGGACGAGTGCTTCGGCAAGTGTACTCGAGTACACTTGCCGAAGCACTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003036.2-992s21c1
Sequence:CCGGTGAAGGAGAAATTCGACTATGCTCGAGCATAGTCGAATTTCTCCTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003036.2-1226s21c1
Sequence:CCGGCAGTGTCAGCGAGTGAGAAAGCTCGAGCTTTCTCACTCGCTGACACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003036.2-1758s21c1
Sequence:CCGGCCTGCATGAGGTGGTCAAGATCTCGAGATCTTGACCACCTCATGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011385
VALIDATED
SKI MISSION shRNA Bacterial Glycerol Stock
v-ski avian sarcoma viral oncogene homolog
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011385.1-976s1c1
Sequence:CCGGCCAGCTTCCATAAGACCCAAACTCGAGTTTGGGTCTTATGGAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011385.1-1647s1c1
Sequence:CCGGCCTGGATACTAAGGAAGCCAACTCGAGTTGGCTTCCTTAGTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011385.1-912s1c1
Sequence:CCGGCGTGAAGGAGAAGTTCGACTACTCGAGTAGTCGAACTTCTCCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011385.1-471s1c1
Sequence:CCGGGATCCTCAAAGTCATGGGCATCTCGAGATGCCCATGACTTTGAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011385.1-1818s1c1
Sequence:CCGGGCGCAATTTGAGGAAAGAGATCTCGAGATCTCTTTCCTCAAATTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011385
VALIDATED
SKI MISSION shRNA shRNA Plasmid DNA
v-ski avian sarcoma viral oncogene homolog
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011385.1-976s1c1
Sequence:CCGGCCAGCTTCCATAAGACCCAAACTCGAGTTTGGGTCTTATGGAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011385.1-1647s1c1
Sequence:CCGGCCTGGATACTAAGGAAGCCAACTCGAGTTGGCTTCCTTAGTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011385.1-912s1c1
Sequence:CCGGCGTGAAGGAGAAGTTCGACTACTCGAGTAGTCGAACTTCTCCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011385.1-471s1c1
Sequence:CCGGGATCCTCAAAGTCATGGGCATCTCGAGATGCCCATGACTTTGAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011385.1-1818s1c1
Sequence:CCGGGCGCAATTTGAGGAAAGAGATCTCGAGATCTCTTTCCTCAAATTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011385
VALIDATED
SKI MISSION shRNA Lentiviral Transduction Particles
v-ski avian sarcoma viral oncogene homolog
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011385.1-976s1c1
Sequence:CCGGCCAGCTTCCATAAGACCCAAACTCGAGTTTGGGTCTTATGGAAGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011385.1-1647s1c1
Sequence:CCGGCCTGGATACTAAGGAAGCCAACTCGAGTTGGCTTCCTTAGTATCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011385.1-912s1c1
Sequence:CCGGCGTGAAGGAGAAGTTCGACTACTCGAGTAGTCGAACTTCTCCTTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011385.1-471s1c1
Sequence:CCGGGATCCTCAAAGTCATGGGCATCTCGAGATGCCCATGACTTTGAGGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011385.1-1818s1c1
Sequence:CCGGGCGCAATTTGAGGAAAGAGATCTCGAGATCTCTTTCCTCAAATTGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)