EMAIL THIS PAGE TO A FRIEND

SLC10A6

solute carrier family 10 (sodium/bile acid cotransporter), member 6

38 Gene Product Result for
Synonyms: SOAT
UniProtKB ID: Q3KNW5, Q70EX7
Gene ID:
Mouse(75750) solute carrier family 10 (sodium/bile acid cotransporter family), member 6
Rat(289459) solute carrier family 10 (sodium/bile acid cotransporter), member 6
Horse(100034105) solute carrier family 10 (sodium/bile acid cotransporter family), member 6
domestic cat(101100717) solute carrier family 10 (sodium/bile acid cotransporter family), member 6
dog(609030) solute carrier family 10 (sodium/bile acid cotransporter family), member 6
cow(540841) solute carrier family 10 (sodium/bile acid cotransporter family), member 6
sheep(101121855) solute carrier family 10 (sodium/bile acid cotransporter family), member 6
domestic guinea pig(100717464) solute carrier family 10 (sodium/bile acid cotransporter family), member 6
naked mole-rat(101717999) solute carrier family 10 (sodium/bile acid cotransporter family), member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_197965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_197965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_197965 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029381 MISSION® esiRNA esiRNA human SLC10A6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_197965 Rosetta Predictions human pricing
NM_198049 Rosetta Predictions rat pricing
NM_029415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217043 predicted 813
2 SASI_Hs01_00217044 predicted 462
3 SASI_Hs01_00217045 predicted 282
4 SASI_Hs02_00371576 predicted 352
5 SASI_Hs01_00217047 predicted 430
6 SASI_Hs01_00217049 predicted 475
7 SASI_Hs02_00371577 predicted 873
8 SASI_Hs01_00217050 predicted 659
9 SASI_Hs01_00217051 predicted 245
10 SASI_Hs01_00217052 predicted 751
11 SASI_Hs01_00217046 predicted 894
12 SASI_Hs01_00217048 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087346 predicted 502
2 SASI_Rn01_00087347 predicted 644
3 SASI_Rn01_00087348 predicted 268
4 SASI_Rn01_00087349 predicted 670
5 SASI_Rn01_00087350 predicted 286
6 SASI_Rn01_00087351 predicted 344
7 SASI_Rn01_00087352 predicted 482
8 SASI_Rn01_00087353 predicted 357
9 SASI_Rn01_00087354 predicted 563
10 SASI_Rn01_00087355 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071178 predicted 456
2 SASI_Mm01_00071179 predicted 393
3 SASI_Mm01_00071180 predicted 313
4 SASI_Mm01_00071181 predicted 441
5 SASI_Mm01_00071182 predicted 647
6 SASI_Mm01_00071183 predicted 516
7 SASI_Mm01_00071184 predicted 1265
8 SASI_Mm01_00071185 predicted 1342
9 SASI_Mm02_00335308 predicted 297
10 SASI_Mm01_00071186 predicted 789
11 SASI_Mm01_00071187 predicted 1085
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197965
SLC10A6 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 10 (sodium/bile acid cotransporter), member 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-684s1c1
Sequence:CCGGCATCAGTTTCATCTTTCCTTTCTCGAGAAAGGAAAGATGAAACTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-481s1c1
Sequence:CCGGCCTTATCAGAACATAGGAATTCTCGAGAATTCCTATGTTCTGATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-465s1c1
Sequence:CCGGGCAGAATCTCACCATTCCTTACTCGAGTAAGGAATGGTGAGATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-764s1c1
Sequence:CCGGGCAGGACAATTTCCTTAGAAACTCGAGTTTCTAAGGAAATTGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-891s1c1
Sequence:CCGGGCTGATAGATGGATTTCTTATCTCGAGATAAGAAATCCATCTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197965.2-1139s21c1
Sequence:CCGGCATACGAGGAAATCGACTTCTCTCGAGAGAAGTCGATTTCCTCGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197965.2-680s21c1
Sequence:CCGGTTTGGTGTCTATGTGAATTACCTCGAGGTAATTCACATAGACACCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197965.2-567s21c1
Sequence:CCGGTGATGCCACTCTGCATTTATCCTCGAGGATAAATGCAGAGTGGCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197965.2-515s21c1
Sequence:CCGGATGGATCTCAGCATCAGTATGCTCGAGCATACTGATGCTGAGATCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197965
SLC10A6 MISSION shRNA shRNA Plasmid DNA
solute carrier family 10 (sodium/bile acid cotransporter), member 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-684s1c1
Sequence:CCGGCATCAGTTTCATCTTTCCTTTCTCGAGAAAGGAAAGATGAAACTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-481s1c1
Sequence:CCGGCCTTATCAGAACATAGGAATTCTCGAGAATTCCTATGTTCTGATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-465s1c1
Sequence:CCGGGCAGAATCTCACCATTCCTTACTCGAGTAAGGAATGGTGAGATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-764s1c1
Sequence:CCGGGCAGGACAATTTCCTTAGAAACTCGAGTTTCTAAGGAAATTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-891s1c1
Sequence:CCGGGCTGATAGATGGATTTCTTATCTCGAGATAAGAAATCCATCTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197965.2-1139s21c1
Sequence:CCGGCATACGAGGAAATCGACTTCTCTCGAGAGAAGTCGATTTCCTCGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197965.2-680s21c1
Sequence:CCGGTTTGGTGTCTATGTGAATTACCTCGAGGTAATTCACATAGACACCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197965.2-567s21c1
Sequence:CCGGTGATGCCACTCTGCATTTATCCTCGAGGATAAATGCAGAGTGGCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197965.2-515s21c1
Sequence:CCGGATGGATCTCAGCATCAGTATGCTCGAGCATACTGATGCTGAGATCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197965
SLC10A6 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 10 (sodium/bile acid cotransporter), member 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-684s1c1
Sequence:CCGGCATCAGTTTCATCTTTCCTTTCTCGAGAAAGGAAAGATGAAACTGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-481s1c1
Sequence:CCGGCCTTATCAGAACATAGGAATTCTCGAGAATTCCTATGTTCTGATAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-465s1c1
Sequence:CCGGGCAGAATCTCACCATTCCTTACTCGAGTAAGGAATGGTGAGATTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-764s1c1
Sequence:CCGGGCAGGACAATTTCCTTAGAAACTCGAGTTTCTAAGGAAATTGTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197965.1-891s1c1
Sequence:CCGGGCTGATAGATGGATTTCTTATCTCGAGATAAGAAATCCATCTATCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197965.2-1139s21c1
Sequence:CCGGCATACGAGGAAATCGACTTCTCTCGAGAGAAGTCGATTTCCTCGTATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197965.2-680s21c1
Sequence:CCGGTTTGGTGTCTATGTGAATTACCTCGAGGTAATTCACATAGACACCAAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197965.2-567s21c1
Sequence:CCGGTGATGCCACTCTGCATTTATCCTCGAGGATAAATGCAGAGTGGCATCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197965.2-515s21c1
Sequence:CCGGATGGATCTCAGCATCAGTATGCTCGAGCATACTGATGCTGAGATCCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029415
SLC10A6 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 10 (sodium/bile acid cotransporter), member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029415.1-1272s1c1
Sequence:CCGGGCCACATTCCTTCATGTGAATCTCGAGATTCACATGAAGGAATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029415.1-705s1c1
Sequence:CCGGCTGGCGTCTATGTGAATTATACTCGAGTATAATTCACATAGACGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029415.1-502s1c1
Sequence:CCGGCATCTCTAATGTTCTCACCTTCTCGAGAAGGTGAGAACATTAGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029415.1-1084s1c1
Sequence:CCGGCGCAGCATATCAGGCATACAACTCGAGTTGTATGCCTGATATGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029415.1-1393s1c1
Sequence:CCGGCCTCCCATTGTGGAATGTAATCTCGAGATTACATTCCACAATGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029415
SLC10A6 MISSION shRNA shRNA Plasmid DNA
solute carrier family 10 (sodium/bile acid cotransporter), member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029415.1-1272s1c1
Sequence:CCGGGCCACATTCCTTCATGTGAATCTCGAGATTCACATGAAGGAATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029415.1-705s1c1
Sequence:CCGGCTGGCGTCTATGTGAATTATACTCGAGTATAATTCACATAGACGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029415.1-502s1c1
Sequence:CCGGCATCTCTAATGTTCTCACCTTCTCGAGAAGGTGAGAACATTAGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029415.1-1084s1c1
Sequence:CCGGCGCAGCATATCAGGCATACAACTCGAGTTGTATGCCTGATATGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029415.1-1393s1c1
Sequence:CCGGCCTCCCATTGTGGAATGTAATCTCGAGATTACATTCCACAATGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029415
SLC10A6 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 10 (sodium/bile acid cotransporter), member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029415.1-1272s1c1
Sequence:CCGGGCCACATTCCTTCATGTGAATCTCGAGATTCACATGAAGGAATGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029415.1-705s1c1
Sequence:CCGGCTGGCGTCTATGTGAATTATACTCGAGTATAATTCACATAGACGCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029415.1-502s1c1
Sequence:CCGGCATCTCTAATGTTCTCACCTTCTCGAGAAGGTGAGAACATTAGAGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029415.1-1084s1c1
Sequence:CCGGCGCAGCATATCAGGCATACAACTCGAGTTGTATGCCTGATATGCTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029415.1-1393s1c1
Sequence:CCGGCCTCCCATTGTGGAATGTAATCTCGAGATTACATTCCACAATGGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)