EMAIL THIS PAGE TO A FRIEND

SLC12A1

solute carrier family 12 (sodium/potassium/chloride transporter), member 1

110 Gene Product Result for
Synonyms: BSC1 NKCC2
UniProtKB ID: Q13621, A8JYA2
Gene ID:
Human(6557) Summary: This gene encodes a kidney-specific sodium-potassium-chloride cotransporter that is expressed on the luminal membrane of renal epithelial cells of the thick ascending limb of Henle's loop and the macula densa. It plays a key role in concentrating urine and accounts for most of the NaCl resorption. It is sensitive to such diuretics as furosemide and bumetanide. Some Bartter-like syndromes result from defects in this gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity in humans has not been experimentally proven.[provided by RefSeq, May 2010]
Mouse(20495) solute carrier family 12, member 1
Rat(25065) solute carrier family 12 (sodium/potassium/chloride transporter), member 1
Zebrafish(100329975) solute carrier family 12, member 1
dog(478292) solute carrier family 12 (sodium/potassium/chloride transporters), member 1
chicken(415433) solute carrier family 12 (sodium/potassium/chloride transporters), member 1
domestic cat(101100216) solute carrier family 12 (sodium/potassium/chloride transporters), member 1
domestic guinea pig(100716647) solute carrier family 12 (sodium/potassium/chloride transporters), member 1
naked mole-rat(101719170) solute carrier family 12 (sodium/potassium/chloride transporters), member 1
Domestic Rabbit(100328575) solute carrier family 12 (sodium/potassium/chloride transporters), member 1
cow(407161) solute carrier family 12 (sodium/potassium/chloride transporters), member 1
sheep(101111371) solute carrier family 12 (sodium/potassium/chloride transporters), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
B3023 Bumetanide ≥98% human pricing
1078303 Bumetanide United States Pharmacopeia (USP) Reference Standard human pricing
B1158000 Bumetanide European Pharmacopoeia (EP) Reference Standard human pricing
BP537 Bumetanide British Pharmacopoeia (BP) Reference Standard human pricing
Y0001263 Etacrynic acid for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
SML1083 Ethacrynic acid ≥97% (HPLC) human pricing
E1800000 Ethacrynic acid European Pharmacopoeia (EP) Reference Standard human pricing
BP143 Ethacrynic acid British Pharmacopoeia (BP) Reference Standard human pricing
1256004 Ethacrynic acid United States Pharmacopeia (USP) Reference Standard human pricing
F4381 Furosemide human pricing
PHR1057 Furosemide Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1287008 Furosemide United States Pharmacopeia (USP) Reference Standard human pricing
F0700000 Furosemide European Pharmacopoeia (EP) Reference Standard human pricing
BP547 Furosemide British Pharmacopoeia (BP) Reference Standard human pricing
Y0001493 Furosemide for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
F-005 Furosemide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M1195 Metolazone ≥98% (HPLC), solid human pricing
Y0000461 Torasemide anhydrous European Pharmacopoeia (EP) Reference Standard human pricing
Y0000462 Torasemide for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
T3202 Torsemide ≥98% (HPLC), solid human pricing
1672304 Torsemide United States Pharmacopeia (USP) Reference Standard human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000338 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000338 Rosetta Predictions human pricing
NM_019134 Rosetta Predictions rat pricing
XM_579419 Rosetta Predictions rat pricing
NM_001079690 Rosetta Predictions mouse pricing
NM_011389 Rosetta Predictions mouse pricing
NM_183354 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085753 predicted 3308
2 SASI_Hs01_00085754 predicted 495
3 SASI_Hs01_00085756 predicted 1102
4 SASI_Hs01_00085757 predicted 2133
5 SASI_Hs02_00302357 predicted 907
6 SASI_Hs01_00085758 predicted 1192
7 SASI_Hs02_00302358 predicted 245
8 SASI_Hs02_00302359 predicted 1787
9 SASI_Hs02_00302360 predicted 890
10 SASI_Hs02_00302361 predicted 2121
11 SASI_Hs01_00085755 predicted 859
12 SASI_Hs01_00085759 predicted 283
13 SASI_Hs01_00085760 predicted 701
14 SASI_Hs01_00085761 predicted 544
15 SASI_Hs01_00085762 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112994 predicted 1975
2 SASI_Rn02_00261880 predicted 3047
3 SASI_Rn01_00112995 predicted 1136
4 SASI_Rn01_00112996 predicted 2564
5 SASI_Rn02_00261881 predicted 3170
6 SASI_Rn02_00261882 predicted 907
7 SASI_Rn01_00112997 predicted 2975
8 SASI_Rn01_00112999 predicted 1255
9 SASI_Rn02_00261883 predicted 1315
10 SASI_Rn01_00113000 predicted 3560
11 SASI_Rn01_00112991 predicted 3389
12 SASI_Rn01_00112992 predicted 3493
13 SASI_Rn01_00112993 predicted 3456
14 SASI_Rn01_00112998 predicted 1894
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143807 predicted 3399
2 SASI_Rn01_00143808 predicted 3492
3 SASI_Rn01_00143809 predicted 3464
4 SASI_Rn01_00143810 predicted 1933
5 SASI_Rn01_00143811 predicted 2528
6 SASI_Rn01_00143812 predicted 2941
7 SASI_Rn01_00143813 predicted 3526
8 SASI_Rn01_00143814 predicted 486
9 SASI_Rn01_00143815 predicted 428
10 SASI_Rn01_00143816 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293022 predicted 1950
2 SASI_Mm02_00293023 predicted 3404
3 SASI_Mm02_00293024 predicted 3018
4 SASI_Mm02_00293025 predicted 2993
5 SASI_Mm02_00293026 predicted 3148
6 SASI_Mm02_00293027 predicted 1967
7 SASI_Mm02_00293028 predicted 2114
8 SASI_Mm02_00293029 predicted 1276
9 SASI_Mm02_00293030 predicted 2109
10 SASI_Mm02_00293031 predicted 2125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171202 predicted 699
2 SASI_Mm01_00171203 predicted 808
3 SASI_Mm01_00171204 predicted 869
4 SASI_Mm01_00171205 predicted 860
5 SASI_Mm01_00171206 predicted 1244
6 SASI_Mm01_00171207 predicted 1272
7 SASI_Mm01_00171208 predicted 1076
8 SASI_Mm01_00171209 predicted 1047
9 SASI_Mm01_00171210 predicted 714
10 SASI_Mm01_00171211 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350469 predicted 1943
2 SASI_Mm02_00350470 predicted 3408
3 SASI_Mm02_00350471 predicted 3026
4 SASI_Mm02_00350472 predicted 2995
5 SASI_Mm02_00350473 predicted 3143
6 SASI_Mm02_00350474 predicted 1974
7 SASI_Mm02_00350475 predicted 2113
8 SASI_Mm01_00196619 predicted 1272
9 SASI_Mm02_00350476 predicted 2103
10 SASI_Mm02_00350477 predicted 2130
11 SASI_Mm01_00196615 predicted 722
12 SASI_Mm01_00196616 predicted 837
13 SASI_Mm01_00196617 predicted 905
14 SASI_Mm01_00196618 predicted 890
15 SASI_Mm01_00196620 predicted 1303
16 SASI_Mm01_00196621 predicted 1104
17 SASI_Mm01_00196622 predicted 1076
18 SASI_Mm01_00196623 predicted 738
19 SASI_Mm01_00196624 predicted 1229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000338
SLC12A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 12 (sodium/potassium/chloride transporter), member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-1721s1c1
Sequence:CCGGGCTCCCATCATCTCCAACTTTCTCGAGAAAGTTGGAGATGATGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-568s1c1
Sequence:CCGGGCTGGTAAGATGCATGCTGAACTCGAGTTCAGCATGCATCTTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-1688s1c1
Sequence:CCGGGCATTTATTCTTATTGCGGAACTCGAGTTCCGCAATAAGAATAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-61s1c1
Sequence:CCGGGCCCAGTAATACCAATCGCTTCTCGAGAAGCGATTGGTATTACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-3014s1c1
Sequence:CCGGCGTCTCCATGAAAGCTGCAAACTCGAGTTTGCAGCTTTCATGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000338.2-1643s21c1
Sequence:CCGGAGTACGGGCTGATGAACAATTCTCGAGAATTGTTCATCAGCCCGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000338.2-2541s21c1
Sequence:CCGGCACTCTGGTGATTGGATATAACTCGAGTTATATCCAATCACCAGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000338
SLC12A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 12 (sodium/potassium/chloride transporter), member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-1721s1c1
Sequence:CCGGGCTCCCATCATCTCCAACTTTCTCGAGAAAGTTGGAGATGATGGGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-568s1c1
Sequence:CCGGGCTGGTAAGATGCATGCTGAACTCGAGTTCAGCATGCATCTTACCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-1688s1c1
Sequence:CCGGGCATTTATTCTTATTGCGGAACTCGAGTTCCGCAATAAGAATAAATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-61s1c1
Sequence:CCGGGCCCAGTAATACCAATCGCTTCTCGAGAAGCGATTGGTATTACTGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-3014s1c1
Sequence:CCGGCGTCTCCATGAAAGCTGCAAACTCGAGTTTGCAGCTTTCATGGAGACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000421955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000338.2-1643s21c1
Sequence:CCGGAGTACGGGCTGATGAACAATTCTCGAGAATTGTTCATCAGCCCGTACTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000418044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000338.2-2541s21c1
Sequence:CCGGCACTCTGGTGATTGGATATAACTCGAGTTATATCCAATCACCAGAGTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000338
SLC12A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 12 (sodium/potassium/chloride transporter), member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-1721s1c1
Sequence:CCGGGCTCCCATCATCTCCAACTTTCTCGAGAAAGTTGGAGATGATGGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-568s1c1
Sequence:CCGGGCTGGTAAGATGCATGCTGAACTCGAGTTCAGCATGCATCTTACCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-1688s1c1
Sequence:CCGGGCATTTATTCTTATTGCGGAACTCGAGTTCCGCAATAAGAATAAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-61s1c1
Sequence:CCGGGCCCAGTAATACCAATCGCTTCTCGAGAAGCGATTGGTATTACTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000338.1-3014s1c1
Sequence:CCGGCGTCTCCATGAAAGCTGCAAACTCGAGTTTGCAGCTTTCATGGAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000338.2-1643s21c1
Sequence:CCGGAGTACGGGCTGATGAACAATTCTCGAGAATTGTTCATCAGCCCGTACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000338.2-2541s21c1
Sequence:CCGGCACTCTGGTGATTGGATATAACTCGAGTTATATCCAATCACCAGAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011389
SLC12A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 12 (sodium/potassium/chloride transporter), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-2100s1c1
Sequence:CCGGCCTCTATATCTATGTGACTTACTCGAGTAAGTCACATAGATATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-1532s1c1
Sequence:CCGGCCATCGTTTCTGGGATGAATTCTCGAGAATTCATCCCAGAAACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-1112s1c1
Sequence:CCGGCCGTGGTGATTCTTCTAGGAACTCGAGTTCCTAGAAGAATCACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-857s1c1
Sequence:CCGGCCTCTATCACTGGGTTGTCAACTCGAGTTGACAACCCAGTGATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-2291s1c1
Sequence:CCGGCCCACGCCTTTACGAAGAATACTCGAGTATTCTTCGTAAAGGCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011389
SLC12A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 12 (sodium/potassium/chloride transporter), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-2100s1c1
Sequence:CCGGCCTCTATATCTATGTGACTTACTCGAGTAAGTCACATAGATATAGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000070014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-1532s1c1
Sequence:CCGGCCATCGTTTCTGGGATGAATTCTCGAGAATTCATCCCAGAAACGATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000070015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-1112s1c1
Sequence:CCGGCCGTGGTGATTCTTCTAGGAACTCGAGTTCCTAGAAGAATCACCACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000070017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-857s1c1
Sequence:CCGGCCTCTATCACTGGGTTGTCAACTCGAGTTGACAACCCAGTGATAGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000070016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-2291s1c1
Sequence:CCGGCCCACGCCTTTACGAAGAATACTCGAGTATTCTTCGTAAAGGCGTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011389
SLC12A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 12 (sodium/potassium/chloride transporter), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-2100s1c1
Sequence:CCGGCCTCTATATCTATGTGACTTACTCGAGTAAGTCACATAGATATAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-1532s1c1
Sequence:CCGGCCATCGTTTCTGGGATGAATTCTCGAGAATTCATCCCAGAAACGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-1112s1c1
Sequence:CCGGCCGTGGTGATTCTTCTAGGAACTCGAGTTCCTAGAAGAATCACCACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-857s1c1
Sequence:CCGGCCTCTATCACTGGGTTGTCAACTCGAGTTGACAACCCAGTGATAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011389.1-2291s1c1
Sequence:CCGGCCCACGCCTTTACGAAGAATACTCGAGTATTCTTCGTAAAGGCGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)