EMAIL THIS PAGE TO A FRIEND

SLC12A8

solute carrier family 12, member 8

95 Gene Product Result for
Synonyms: CCC9
Gene ID:
Human(84561) Summary: This gene is thought to be a candidate for psoriasis susceptibility. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2010]
Mouse(171286) solute carrier family 12 (potassium/chloride transporters), member 8
Rat(266733) solute carrier family 12, member 8
Zebrafish(100000006) solute carrier family 12 (potassium/chloride transporters), member 8
dog(488016) solute carrier family 12 (potassium/chloride transporters), member 8
domestic cat(101095604) solute carrier family 12 (potassium/chloride transporters), member 8
Horse(100070338) solute carrier family 12 (potassium/chloride transporters), member 8
chicken(424258) solute carrier family 12 (potassium/chloride transporters), member 8
cow(521454) solute carrier family 12, member 8
sheep(101116787) solute carrier family 12 (potassium/chloride transporters), member 8
naked mole-rat(101703400) solute carrier family 12 (potassium/chloride transporters), member 8
Domestic Rabbit(100352782) solute carrier family 12 (potassium/chloride transporters), member 8
domestic guinea pig(100736177) solute carrier family 12 (potassium/chloride transporters), member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA031123 Anti-SLC12A8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2105554 Anti-SLC12A8, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, bovine, rabbit, dog, human, mouse, guinea pig, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024628 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024628 Rosetta Predictions human pricing
NM_153625 Rosetta Predictions rat pricing
NM_001083902 Rosetta Predictions mouse pricing
NM_134251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035335 predicted 543
2 SASI_Hs01_00035337 predicted 688
3 SASI_Hs01_00035339 predicted 1714
4 SASI_Hs01_00035340 predicted 840
5 SASI_Hs02_00357007 predicted 330
6 SASI_Hs01_00035341 predicted 617
7 SASI_Hs01_00035343 predicted 724
8 SASI_Hs01_00035344 predicted 1791
9 SASI_Hs02_00357008 predicted 1762
10 SASI_Hs02_00357009 predicted 1283
11 SASI_Hs01_00035336 predicted 1091
12 SASI_Hs01_00035338 predicted 492
13 SASI_Hs01_00035342 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030161 predicted 729
2 SASI_Rn01_00030162 predicted 685
3 SASI_Rn01_00030163 predicted 1652
4 SASI_Rn01_00030166 predicted 416
5 SASI_Rn01_00030167 predicted 1527
6 SASI_Rn01_00030168 predicted 2065
7 SASI_Rn01_00030169 predicted 1650
8 SASI_Rn02_00268997 predicted 443
9 SASI_Rn01_00030170 predicted 725
10 SASI_Rn02_00268998 predicted 869
11 SASI_Rn01_00030164 predicted 626
12 SASI_Rn01_00030165 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299911 predicted 1324
2 SASI_Mm02_00299912 predicted 1487
3 SASI_Mm02_00299913 predicted 1507
4 SASI_Mm02_00299914 predicted 1279
5 SASI_Mm02_00299915 predicted 1260
6 SASI_Mm02_00299916 predicted 1490
7 SASI_Mm02_00299917 predicted 1976
8 SASI_Mm02_00299918 predicted 1586
9 SASI_Mm02_00299919 predicted 1337
10 SASI_Mm02_00299920 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184232 predicted 1437
2 SASI_Mm01_00184233 predicted 1598
3 SASI_Mm01_00184235 predicted 1625
4 SASI_Mm01_00184236 predicted 1396
5 SASI_Mm01_00184238 predicted 1378
6 SASI_Mm02_00339556 predicted 1607
7 SASI_Mm01_00184239 predicted 2095
8 SASI_Mm01_00184240 predicted 1702
9 SASI_Mm01_00184241 predicted 1446
10 SASI_Mm02_00339557 predicted 1685
11 SASI_Mm01_00184234 predicted 724
12 SASI_Mm01_00184237 predicted 1104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024628
SLC12A8 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 12, member 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-488s1c1
Sequence:CCGGGCCATGTATATCACCGGCTTTCTCGAGAAAGCCGGTGATATACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-1585s1c1
Sequence:CCGGCCTACAAGATAGCTTCCTCTTCTCGAGAAGAGGAAGCTATCTTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-604s1c1
Sequence:CCGGCGCAGGTGTCAAATGGATAATCTCGAGATTATCCATTTGACACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-1900s1c1
Sequence:CCGGCCTTCTCATCATGTTTGTGATCTCGAGATCACAAACATGATGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-1541s1c1
Sequence:CCGGCCAGAAAGTCAGAAGAGGAAACTCGAGTTTCCTCTTCTGACTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024628.5-2367s21c1
Sequence:CCGGCCGCTGTCACTTTGGACAATGCTCGAGCATTGTCCAAAGTGACAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024628.5-697s21c1
Sequence:CCGGGACTTTGTGGTGGGTTCTTTCCTCGAGGAAAGAACCCACCACAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024628
SLC12A8 MISSION shRNA shRNA Plasmid DNA
solute carrier family 12, member 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-488s1c1
Sequence:CCGGGCCATGTATATCACCGGCTTTCTCGAGAAAGCCGGTGATATACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-1585s1c1
Sequence:CCGGCCTACAAGATAGCTTCCTCTTCTCGAGAAGAGGAAGCTATCTTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-604s1c1
Sequence:CCGGCGCAGGTGTCAAATGGATAATCTCGAGATTATCCATTTGACACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-1900s1c1
Sequence:CCGGCCTTCTCATCATGTTTGTGATCTCGAGATCACAAACATGATGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-1541s1c1
Sequence:CCGGCCAGAAAGTCAGAAGAGGAAACTCGAGTTTCCTCTTCTGACTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024628.5-2367s21c1
Sequence:CCGGCCGCTGTCACTTTGGACAATGCTCGAGCATTGTCCAAAGTGACAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024628.5-697s21c1
Sequence:CCGGGACTTTGTGGTGGGTTCTTTCCTCGAGGAAAGAACCCACCACAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024628
SLC12A8 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 12, member 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-488s1c1
Sequence:CCGGGCCATGTATATCACCGGCTTTCTCGAGAAAGCCGGTGATATACATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-1585s1c1
Sequence:CCGGCCTACAAGATAGCTTCCTCTTCTCGAGAAGAGGAAGCTATCTTGTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-604s1c1
Sequence:CCGGCGCAGGTGTCAAATGGATAATCTCGAGATTATCCATTTGACACCTGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-1900s1c1
Sequence:CCGGCCTTCTCATCATGTTTGTGATCTCGAGATCACAAACATGATGAGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000043002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024628.4-1541s1c1
Sequence:CCGGCCAGAAAGTCAGAAGAGGAAACTCGAGTTTCCTCTTCTGACTTTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000428417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024628.5-2367s21c1
Sequence:CCGGCCGCTGTCACTTTGGACAATGCTCGAGCATTGTCCAAAGTGACAGCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000428600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024628.5-697s21c1
Sequence:CCGGGACTTTGTGGTGGGTTCTTTCCTCGAGGAAAGAACCCACCACAAAGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134251
SLC12A8 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 12, member 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134251.1-2276s1c1
Sequence:CCGGGCCAGATACTAGGTATGACTACTCGAGTAGTCATACCTAGTATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134251.1-1419s1c1
Sequence:CCGGGCTTGGGTCAAGAGAAGGAAACTCGAGTTTCCTTCTCTTGACCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134251.1-462s1c1
Sequence:CCGGGCGTGGAATTTCAGTTGCTGTCTCGAGACAGCAACTGAAATTCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134251.1-1487s1c1
Sequence:CCGGCCCTACAAGATAGCTTCCTCTCTCGAGAGAGGAAGCTATCTTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134251.1-1840s1c1
Sequence:CCGGGCCCTTGTGTATTTCTACATTCTCGAGAATGTAGAAATACACAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134251
SLC12A8 MISSION shRNA shRNA Plasmid DNA
solute carrier family 12, member 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134251.1-2276s1c1
Sequence:CCGGGCCAGATACTAGGTATGACTACTCGAGTAGTCATACCTAGTATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134251.1-1419s1c1
Sequence:CCGGGCTTGGGTCAAGAGAAGGAAACTCGAGTTTCCTTCTCTTGACCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134251.1-462s1c1
Sequence:CCGGGCGTGGAATTTCAGTTGCTGTCTCGAGACAGCAACTGAAATTCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134251.1-1487s1c1
Sequence:CCGGCCCTACAAGATAGCTTCCTCTCTCGAGAGAGGAAGCTATCTTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134251.1-1840s1c1
Sequence:CCGGGCCCTTGTGTATTTCTACATTCTCGAGAATGTAGAAATACACAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134251
SLC12A8 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 12, member 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134251.1-2276s1c1
Sequence:CCGGGCCAGATACTAGGTATGACTACTCGAGTAGTCATACCTAGTATCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134251.1-1419s1c1
Sequence:CCGGGCTTGGGTCAAGAGAAGGAAACTCGAGTTTCCTTCTCTTGACCCAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134251.1-462s1c1
Sequence:CCGGGCGTGGAATTTCAGTTGCTGTCTCGAGACAGCAACTGAAATTCCACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134251.1-1487s1c1
Sequence:CCGGCCCTACAAGATAGCTTCCTCTCTCGAGAGAGGAAGCTATCTTGTAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000079284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134251.1-1840s1c1
Sequence:CCGGGCCCTTGTGTATTTCTACATTCTCGAGAATGTAGAAATACACAAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???