EMAIL THIS PAGE TO A FRIEND

SLC15A1

solute carrier family 15 (oligopeptide transporter), member 1

68 Gene Product Result for
Synonyms: HPECT1 HPEPT1 PEPT1
UniProtKB ID: P46059, Q5VW82
Gene ID:
Human(6564) Summary: This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
Mouse(56643) solute carrier family 15 (oligopeptide transporter), member 1
Rat(117261) solute carrier family 15 (oligopeptide transporter), member 1
domestic guinea pig(100713596) solute carrier family 15 (oligopeptide transporter), member 1
Domestic Rabbit(100009186) solute carrier family 15 (oligopeptide transporter), member 1
naked mole-rat(101717133) solute carrier family 15 (oligopeptide transporter), member 1
cow(521181) solute carrier family 15 (oligopeptide transporter), member 1
chicken(378789) solute carrier family 15 (oligopeptide transporter), member 1
domestic cat(101100174) solute carrier family 15 (oligopeptide transporter), member 1
dog(403561) solute carrier family 15 (oligopeptide transporter), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053079 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053079 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053079 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005073 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157011 MISSION® esiRNA esiRNA human SLC15A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005073 Rosetta Predictions human pricing
NM_001079838 Rosetta Predictions rat pricing
NM_057121 Rosetta Predictions rat pricing
XM_579593 Rosetta Predictions rat pricing
NM_053079 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057727 predicted 1587
2 SASI_Hs01_00057728 predicted 1551
3 SASI_Hs01_00057729 predicted 1454
4 SASI_Hs01_00057730 predicted 1297
5 SASI_Hs01_00057731 predicted 2041
6 SASI_Hs01_00057732 predicted 2084
7 SASI_Hs01_00057733 predicted 554
8 SASI_Hs02_00338906 predicted 1569
9 SASI_Hs02_00338907 predicted 1001
10 SASI_Hs01_00057734 predicted 1706
11 SASI_Hs01_00057735 predicted 357
12 SASI_Hs01_00057736 predicted 1656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208139 predicted 357
2 SASI_Rn02_00208140 predicted 345
3 SASI_Rn02_00208141 predicted 342
4 SASI_Rn02_00208142 predicted 344
5 SASI_Rn02_00208143 predicted 301
6 SASI_Rn02_00208144 predicted 334
7 SASI_Rn02_00208145 predicted 389
8 SASI_Rn02_00208146 predicted 331
9 SASI_Rn02_00208147 predicted 376
10 SASI_Rn02_00208148 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267055 predicted 1987
2 SASI_Rn02_00267056 predicted 1982
3 SASI_Rn02_00267057 predicted 1980
4 SASI_Rn02_00267058 predicted 1981
5 SASI_Rn02_00267059 predicted 1936
6 SASI_Rn02_00267060 predicted 1969
7 SASI_Rn02_00267061 predicted 2027
8 SASI_Rn02_00267062 predicted 1961
9 SASI_Rn02_00267063 predicted 2010
10 SASI_Rn02_00267064 predicted 1963
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00196776 predicted 598
2 SASI_Rn01_00196777 predicted 502
3 SASI_Rn01_00196778 predicted 304
4 SASI_Rn01_00196779 predicted 339
5 SASI_Rn01_00196780 predicted 476
6 SASI_Rn01_00196781 predicted 344
7 SASI_Rn01_00196782 predicted 387
8 SASI_Rn01_00196783 predicted 354
9 SASI_Rn01_00196784 predicted 681
10 SASI_Rn01_00196785 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337557 predicted 780
2 SASI_Mm02_00337558 predicted 1139
3 SASI_Mm02_00337559 predicted 282
4 SASI_Mm02_00337560 predicted 1919
5 SASI_Mm02_00337561 predicted 2022
6 SASI_Mm02_00337562 predicted 1307
7 SASI_Mm02_00337563 predicted 222
8 SASI_Mm02_00337564 predicted 649
9 SASI_Mm02_00337565 predicted 2040
10 SASI_Mm02_00337566 predicted 1497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053079
SLC15A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 15 (oligopeptide transporter), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053079.1-1918s1c1
Sequence:CCGGCGGCAATATCATTGTGCTCATCTCGAGATGAGCACAATGATATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053079.1-2165s1c1
Sequence:CCGGGCAGAAGGCAAATTGGAGAAACTCGAGTTTCTCCAATTTGCCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053079.1-844s1c1
Sequence:CCGGGCGGCTCATCTCACAGATTAACTCGAGTTAATCTGTGAGATGAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053079.1-1434s1c1
Sequence:CCGGCCAGTCAATACCGTGTGGTAACTCGAGTTACCACACGGTATTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053079.1-1203s1c1
Sequence:CCGGGTGGAAATCAAGTCCAAATTACTCGAGTAATTTGGACTTGATTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053079
SLC15A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 15 (oligopeptide transporter), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053079.1-1918s1c1
Sequence:CCGGCGGCAATATCATTGTGCTCATCTCGAGATGAGCACAATGATATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053079.1-2165s1c1
Sequence:CCGGGCAGAAGGCAAATTGGAGAAACTCGAGTTTCTCCAATTTGCCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053079.1-844s1c1
Sequence:CCGGGCGGCTCATCTCACAGATTAACTCGAGTTAATCTGTGAGATGAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053079.1-1434s1c1
Sequence:CCGGCCAGTCAATACCGTGTGGTAACTCGAGTTACCACACGGTATTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053079.1-1203s1c1
Sequence:CCGGGTGGAAATCAAGTCCAAATTACTCGAGTAATTTGGACTTGATTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053079
SLC15A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 15 (oligopeptide transporter), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053079.1-1918s1c1
Sequence:CCGGCGGCAATATCATTGTGCTCATCTCGAGATGAGCACAATGATATTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053079.1-2165s1c1
Sequence:CCGGGCAGAAGGCAAATTGGAGAAACTCGAGTTTCTCCAATTTGCCTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053079.1-844s1c1
Sequence:CCGGGCGGCTCATCTCACAGATTAACTCGAGTTAATCTGTGAGATGAGCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053079.1-1434s1c1
Sequence:CCGGCCAGTCAATACCGTGTGGTAACTCGAGTTACCACACGGTATTGACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053079.1-1203s1c1
Sequence:CCGGGTGGAAATCAAGTCCAAATTACTCGAGTAATTTGGACTTGATTTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005073
SLC15A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 15 (oligopeptide transporter), member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-287s1c1
Sequence:CCGGGCTGGGAAAGTTCAAGACCATCTCGAGATGGTCTTGAACTTTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-869s1c1
Sequence:CCGGGCGGCTCATCTCCCAAATTAACTCGAGTTAATTTGGGAGATGAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-1663s1c1
Sequence:CCGGCGCCACAATGTCAACCTAATTCTCGAGAATTAGGTTGACATTGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-1005s1c1
Sequence:CCGGGCTCTTGAAATTCAGCCCGATCTCGAGATCGGGCTGAATTTCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-2082s1c1
Sequence:CCGGGCGGAGATCGAAGCTCAATTTCTCGAGAAATTGAGCTTCGATCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005073
SLC15A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 15 (oligopeptide transporter), member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-287s1c1
Sequence:CCGGGCTGGGAAAGTTCAAGACCATCTCGAGATGGTCTTGAACTTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-869s1c1
Sequence:CCGGGCGGCTCATCTCCCAAATTAACTCGAGTTAATTTGGGAGATGAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-1663s1c1
Sequence:CCGGCGCCACAATGTCAACCTAATTCTCGAGAATTAGGTTGACATTGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-1005s1c1
Sequence:CCGGGCTCTTGAAATTCAGCCCGATCTCGAGATCGGGCTGAATTTCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-2082s1c1
Sequence:CCGGGCGGAGATCGAAGCTCAATTTCTCGAGAAATTGAGCTTCGATCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005073
SLC15A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 15 (oligopeptide transporter), member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-287s1c1
Sequence:CCGGGCTGGGAAAGTTCAAGACCATCTCGAGATGGTCTTGAACTTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-869s1c1
Sequence:CCGGGCGGCTCATCTCCCAAATTAACTCGAGTTAATTTGGGAGATGAGCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-1663s1c1
Sequence:CCGGCGCCACAATGTCAACCTAATTCTCGAGAATTAGGTTGACATTGTGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-1005s1c1
Sequence:CCGGGCTCTTGAAATTCAGCCCGATCTCGAGATCGGGCTGAATTTCAAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005073.1-2082s1c1
Sequence:CCGGGCGGAGATCGAAGCTCAATTTCTCGAGAAATTGAGCTTCGATCTCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)