EMAIL THIS PAGE TO A FRIEND

SLC17A1

solute carrier family 17 (organic anion transporter), member 1

56 Gene Product Result for
Synonyms: NAPI-1 NPT-1 NPT1
Gene ID:
Mouse(20504) solute carrier family 17 (sodium phosphate), member 1
Rat(171080) solute carrier family 17 (organic anion transporter), member 1
dog(100683700) solute carrier family 17 (sodium phosphate), member 1
domestic cat(101096062) solute carrier family 17 (sodium phosphate), member 1
cow(507535) solute carrier family 17 (organic anion transporter), member 1
sheep(101115166) solute carrier family 17 (sodium phosphate), member 1
Domestic Rabbit(100009144) solute carrier family 17 (sodium phosphate), member 1
naked mole-rat(101712841) solute carrier family 17 (sodium phosphate), member 1
domestic guinea pig(100726650) solute carrier family 17 (sodium phosphate), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P6801 Sodium phosphonoformate tribasic hexahydrate human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005074 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043981 MISSION® esiRNA esiRNA human SLC17A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005074 Rosetta Predictions human pricing
NM_133554 Rosetta Predictions rat pricing
NM_009198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226105 predicted 1093
2 SASI_Hs02_00338908 predicted 912
3 SASI_Hs01_00226107 predicted 1334
4 SASI_Hs01_00226108 predicted 781
5 SASI_Hs01_00226110 predicted 663
6 SASI_Hs02_00338909 predicted 1467
7 SASI_Hs02_00338910 predicted 503
8 SASI_Hs01_00226113 predicted 1104
9 SASI_Hs02_00338911 predicted 855
10 SASI_Hs01_00226114 predicted 877
11 SASI_Hs01_00226106 predicted 1325
12 SASI_Hs01_00226109 predicted 858
13 SASI_Hs01_00226111 predicted 743
14 SASI_Hs01_00226112 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121595 predicted 350
2 SASI_Rn01_00121597 predicted 681
3 SASI_Rn01_00121598 predicted 1063
4 SASI_Rn01_00121599 predicted 1411
5 SASI_Rn02_00267743 predicted 404
6 SASI_Rn01_00121600 predicted 438
7 SASI_Rn01_00121601 predicted 976
8 SASI_Rn01_00121602 predicted 1297
9 SASI_Rn01_00121603 predicted 299
10 SASI_Rn01_00121604 predicted 1219
11 SASI_Rn01_00121596 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125379 predicted 1411
2 SASI_Mm01_00125380 predicted 1142
3 SASI_Mm01_00125381 predicted 887
4 SASI_Mm01_00125382 predicted 1288
5 SASI_Mm01_00125383 predicted 1453
6 SASI_Mm01_00125384 predicted 202
7 SASI_Mm01_00125385 predicted 572
8 SASI_Mm01_00125386 predicted 859
9 SASI_Mm01_00125388 predicted 985
10 SASI_Mm02_00315576 predicted 588
11 SASI_Mm01_00125387 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005074
SLC17A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 17 (organic anion transporter), member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005074.3-412s21c1
Sequence:CCGGGATACTTCTCTGGAATATATTCTCGAGAATATATTCCAGAGAAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005074.3-1432s21c1
Sequence:CCGGTTAATGTGACTGGCCTAATTTCTCGAGAAATTAGGCCAGTCACATTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-1172s1c1
Sequence:CCGGGCTTGGATATTGCTCCCAGATCTCGAGATCTGGGAGCAATATCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-515s1c1
Sequence:CCGGGCCGACTTACTTCTATGAGTACTCGAGTACTCATAGAAGTAAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-62s1c1
Sequence:CCGGCCTTTCGCTATGGATTGTCTTCTCGAGAAGACAATCCATAGCGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-992s1c1
Sequence:CCGGCCAGGAATATTCTCAGCGTAACTCGAGTTACGCTGAGAATATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-201s1c1
Sequence:CCGGGCTCCTGGATAATATAAAGAACTCGAGTTCTTTATATTATCCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005074
SLC17A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 17 (organic anion transporter), member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005074.3-412s21c1
Sequence:CCGGGATACTTCTCTGGAATATATTCTCGAGAATATATTCCAGAGAAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005074.3-1432s21c1
Sequence:CCGGTTAATGTGACTGGCCTAATTTCTCGAGAAATTAGGCCAGTCACATTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-1172s1c1
Sequence:CCGGGCTTGGATATTGCTCCCAGATCTCGAGATCTGGGAGCAATATCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-515s1c1
Sequence:CCGGGCCGACTTACTTCTATGAGTACTCGAGTACTCATAGAAGTAAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-62s1c1
Sequence:CCGGCCTTTCGCTATGGATTGTCTTCTCGAGAAGACAATCCATAGCGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-992s1c1
Sequence:CCGGCCAGGAATATTCTCAGCGTAACTCGAGTTACGCTGAGAATATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-201s1c1
Sequence:CCGGGCTCCTGGATAATATAAAGAACTCGAGTTCTTTATATTATCCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005074
SLC17A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 17 (organic anion transporter), member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005074.3-412s21c1
Sequence:CCGGGATACTTCTCTGGAATATATTCTCGAGAATATATTCCAGAGAAGTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005074.3-1432s21c1
Sequence:CCGGTTAATGTGACTGGCCTAATTTCTCGAGAAATTAGGCCAGTCACATTAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-1172s1c1
Sequence:CCGGGCTTGGATATTGCTCCCAGATCTCGAGATCTGGGAGCAATATCCAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-515s1c1
Sequence:CCGGGCCGACTTACTTCTATGAGTACTCGAGTACTCATAGAAGTAAGTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-62s1c1
Sequence:CCGGCCTTTCGCTATGGATTGTCTTCTCGAGAAGACAATCCATAGCGAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-992s1c1
Sequence:CCGGCCAGGAATATTCTCAGCGTAACTCGAGTTACGCTGAGAATATTCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005074.1-201s1c1
Sequence:CCGGGCTCCTGGATAATATAAAGAACTCGAGTTCTTTATATTATCCAGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009198
SLC17A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 17 (organic anion transporter), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009198.2-1318s1c1
Sequence:CCGGGCTCCCAGATATTATGGATTTCTCGAGAAATCCATAATATCTGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009198.2-606s1c1
Sequence:CCGGCCAGCATGAAATATGGGTCAACTCGAGTTGACCCATATTTCATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009198.2-1156s1c1
Sequence:CCGGCGGAAACTCTTCACCACACTACTCGAGTAGTGTGGTGAAGAGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009198.2-1624s1c1
Sequence:CCGGGCCTAGACTAATGTCTCTGAACTCGAGTTCAGAGACATTAGTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009198.2-225s1c1
Sequence:CCGGGCACTTCTGTAACATTGCCATCTCGAGATGGCAATGTTACAGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009198
SLC17A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 17 (organic anion transporter), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009198.2-1318s1c1
Sequence:CCGGGCTCCCAGATATTATGGATTTCTCGAGAAATCCATAATATCTGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009198.2-606s1c1
Sequence:CCGGCCAGCATGAAATATGGGTCAACTCGAGTTGACCCATATTTCATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009198.2-1156s1c1
Sequence:CCGGCGGAAACTCTTCACCACACTACTCGAGTAGTGTGGTGAAGAGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009198.2-1624s1c1
Sequence:CCGGGCCTAGACTAATGTCTCTGAACTCGAGTTCAGAGACATTAGTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009198.2-225s1c1
Sequence:CCGGGCACTTCTGTAACATTGCCATCTCGAGATGGCAATGTTACAGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009198
SLC17A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 17 (organic anion transporter), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009198.2-1318s1c1
Sequence:CCGGGCTCCCAGATATTATGGATTTCTCGAGAAATCCATAATATCTGGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009198.2-606s1c1
Sequence:CCGGCCAGCATGAAATATGGGTCAACTCGAGTTGACCCATATTTCATGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009198.2-1156s1c1
Sequence:CCGGCGGAAACTCTTCACCACACTACTCGAGTAGTGTGGTGAAGAGTTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009198.2-1624s1c1
Sequence:CCGGGCCTAGACTAATGTCTCTGAACTCGAGTTCAGAGACATTAGTCTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009198.2-225s1c1
Sequence:CCGGGCACTTCTGTAACATTGCCATCTCGAGATGGCAATGTTACAGAAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)