EMAIL THIS PAGE TO A FRIEND

SLC17A6

solute carrier family 17 (vesicular glutamate transporter), member 6

177 Gene Product Result for
Synonyms: DNPI VGLUT2
UniProtKB ID: Q9P2U8, A6NKS2
Gene ID:
Mouse(140919) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Rat(84487) solute carrier family 17 (vesicular glutamate transporter), member 6
domestic guinea pig(100728312) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
naked mole-rat(101697739) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
cow(100125225) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
sheep(101112431) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
chicken(422971) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
domestic cat(101098576) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
dog(100316859) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305661 ANTI-MOUSE VGLU2 ANDIBODY (C-TERM) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
MAB5504 Anti-Vesicular Glutamate Transporter 2 Antibody Detect Vesicular Glutamate Transporter 2 using this Anti-Vesicular Glutamate Transporter 2 Antibody validated for use in WB, IH. mouse, rat, mouse, human, rat
immunohistochemistry, western blot pricing
V2514 Anti-VGLUT2 (HY-19) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat
western blot pricing
V2639 Anti-VGLUT2 (KS-22) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat
microarray, western blot pricing
HPA039226 Anti-VGLUT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB5200285 Monoclonal Anti-Vglut2 - Alkaline Phosphatase antibody produced in mouse clone S29-29, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5200286 Monoclonal Anti-Vglut2 - Apc antibody produced in mouse clone S29-29, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5200277 Monoclonal Anti-Vglut2 - Atto 390 antibody produced in mouse clone S29-29, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5200278 Monoclonal Anti-Vglut2 - Atto 488 antibody produced in mouse clone S29-29, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5200279 Monoclonal Anti-Vglut2 - Atto 565 antibody produced in mouse clone S29-29, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5200280 Monoclonal Anti-Vglut2 - Atto 594 antibody produced in mouse clone S29-29, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5200281 Monoclonal Anti-Vglut2 - Atto 633 antibody produced in mouse clone S29-29, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5200282 Monoclonal Anti-Vglut2 - Atto 655 antibody produced in mouse clone S29-29, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5200283 Monoclonal Anti-Vglut2 - Atto 680 antibody produced in mouse clone S29-29, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5200284 Monoclonal Anti-Vglut2 - Atto 700 antibody produced in mouse clone S29-29, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5200287 Monoclonal Anti-Vglut2 - Biotin antibody produced in mouse clone S29-29, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5200288 Monoclonal Anti-Vglut2 - Fitc antibody produced in mouse clone S29-29, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5200289 Monoclonal Anti-Vglut2 - Hrp antibody produced in mouse clone S29-29, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5200290 Monoclonal Anti-Vglut2 - PE/Atto 594 antibody produced in mouse clone S29-29, purified immunoglobulin mouse, rat
immunohistochemistry, western blot pricing
SAB5200291 Monoclonal Anti-Vglut2 - PerCP antibody produced in mouse clone S29-29, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5200292 Monoclonal Anti-Vglut2 - Rpe antibody produced in mouse clone S29-29, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5200293 Monoclonal Anti-Vglut2 - Streptavidin antibody produced in mouse clone S29-29, purified immunoglobulin rat, mouse
immunohistochemistry, western blot pricing
SAB5200276 Monoclonal Anti-Vglut2 antibody produced in mouse clone S29-29, purified immunoglobulin mouse, human, rat
immunohistochemistry, western blot pricing
AMAB91081 Monoclonal Anti-VGLUT2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2921, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation human, mouse, rat
immunohistochemistry pricing
AMAB91086 Monoclonal Anti-VGLUT2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2952, purified immunoglobulin, buffered aqueous glycerol solution rat, mouse, human
immunohistochemistry pricing
AG209 Vesicular Glutamate Transporter 2, control peptide for AB5907 cell analysis pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020346 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020346 Rosetta Predictions human pricing
NM_053427 Rosetta Predictions rat pricing
NM_080853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231782 predicted 1866
2 SASI_Hs01_00231783 predicted 1536
3 SASI_Hs01_00231785 predicted 1665
4 SASI_Hs02_00353279 predicted 1896
5 SASI_Hs01_00231786 predicted 2140
6 SASI_Hs01_00231787 predicted 1765
7 SASI_Hs02_00353280 predicted 2030
8 SASI_Hs01_00231788 predicted 1792
9 SASI_Hs01_00231789 predicted 1723
10 SASI_Hs01_00231791 predicted 1717
11 SASI_Hs01_00231784 predicted 2113
12 SASI_Hs01_00231790 predicted 2136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076470 predicted 1400
2 SASI_Rn01_00076471 predicted 1781
3 SASI_Rn01_00076472 predicted 1555
4 SASI_Rn01_00076473 predicted 1917
5 SASI_Rn01_00076474 predicted 1596
6 SASI_Rn01_00076475 predicted 2177
7 SASI_Rn01_00076476 predicted 953
8 SASI_Rn01_00076477 predicted 2243
9 SASI_Rn01_00076478 predicted 1506
10 SASI_Rn02_00265979 predicted 872
11 SASI_Rn01_00076469 predicted 2214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109064 predicted 2185
2 SASI_Mm01_00109065 predicted 2166
3 SASI_Mm01_00109067 predicted 2282
4 SASI_Mm01_00109068 predicted 2256
5 SASI_Mm01_00109069 predicted 1665
6 SASI_Mm01_00109070 predicted 1933
7 SASI_Mm01_00109071 predicted 1294
8 SASI_Mm02_00338226 predicted 1131
9 SASI_Mm01_00109072 predicted 2112
10 SASI_Mm02_00338227 predicted 1943
11 SASI_Mm01_00109063 predicted 979
12 SASI_Mm01_00109066 predicted 2094
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080853
VALIDATED
SLC17A6 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 17 (vesicular glutamate transporter), member 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080853.2-2523s1c1
Sequence:CCGGCCGTCTTCATTCAGGCCATTTCTCGAGAAATGGCCTGAATGAAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080853.2-1947s1c1
Sequence:CCGGGCCCTATCATTGTTGGTGCAACTCGAGTTGCACCAACAATGATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080853.2-2187s1c1
Sequence:CCGGCCACCAAATCTTACGGTGCTACTCGAGTAGCACCGTAAGATTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080853.2-1059s1c1
Sequence:CCGGCCCTCAATATGCTGATCCCATCTCGAGATGGGATCAGCATATTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080853.2-1370s1c1
Sequence:CCGGCCTGCAAAGCATCCTACCATTCTCGAGAATGGTAGGATGCTTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080853.3-1296s21c1
Sequence:CCGGCCCTCAATATGCTGATCCCATCTCGAGATGGGATCAGCATATTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080853.3-1733s21c1
Sequence:CCGGATGCCCGTCTACGCGATAATTCTCGAGAATTATCGCGTAGACGGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080853.3-2264s21c1
Sequence:CCGGCACTATGGTGGAGTCATATTTCTCGAGAAATATGACTCCACCATAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080853.3-1219s21c1
Sequence:CCGGCCAGATTCCAGGAGGATATATCTCGAGATATATCCTCCTGGAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080853.3-2760s21c1
Sequence:CCGGCCGTCTTCATTCAGGCCATTTCTCGAGAAATGGCCTGAATGAAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080853
VALIDATED
SLC17A6 MISSION shRNA shRNA Plasmid DNA
solute carrier family 17 (vesicular glutamate transporter), member 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080853.2-2523s1c1
Sequence:CCGGCCGTCTTCATTCAGGCCATTTCTCGAGAAATGGCCTGAATGAAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080853.2-1947s1c1
Sequence:CCGGGCCCTATCATTGTTGGTGCAACTCGAGTTGCACCAACAATGATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080853.2-2187s1c1
Sequence:CCGGCCACCAAATCTTACGGTGCTACTCGAGTAGCACCGTAAGATTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080853.2-1059s1c1
Sequence:CCGGCCCTCAATATGCTGATCCCATCTCGAGATGGGATCAGCATATTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080853.2-1370s1c1
Sequence:CCGGCCTGCAAAGCATCCTACCATTCTCGAGAATGGTAGGATGCTTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080853.3-1296s21c1
Sequence:CCGGCCCTCAATATGCTGATCCCATCTCGAGATGGGATCAGCATATTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080853.3-1733s21c1
Sequence:CCGGATGCCCGTCTACGCGATAATTCTCGAGAATTATCGCGTAGACGGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080853.3-2264s21c1
Sequence:CCGGCACTATGGTGGAGTCATATTTCTCGAGAAATATGACTCCACCATAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080853.3-1219s21c1
Sequence:CCGGCCAGATTCCAGGAGGATATATCTCGAGATATATCCTCCTGGAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080853.3-2760s21c1
Sequence:CCGGCCGTCTTCATTCAGGCCATTTCTCGAGAAATGGCCTGAATGAAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080853
VALIDATED
SLC17A6 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 17 (vesicular glutamate transporter), member 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080853.2-2523s1c1
Sequence:CCGGCCGTCTTCATTCAGGCCATTTCTCGAGAAATGGCCTGAATGAAGACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080853.2-1947s1c1
Sequence:CCGGGCCCTATCATTGTTGGTGCAACTCGAGTTGCACCAACAATGATAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080853.2-2187s1c1
Sequence:CCGGCCACCAAATCTTACGGTGCTACTCGAGTAGCACCGTAAGATTTGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080853.2-1059s1c1
Sequence:CCGGCCCTCAATATGCTGATCCCATCTCGAGATGGGATCAGCATATTGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080853.2-1370s1c1
Sequence:CCGGCCTGCAAAGCATCCTACCATTCTCGAGAATGGTAGGATGCTTTGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080853.3-1296s21c1
Sequence:CCGGCCCTCAATATGCTGATCCCATCTCGAGATGGGATCAGCATATTGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080853.3-1733s21c1
Sequence:CCGGATGCCCGTCTACGCGATAATTCTCGAGAATTATCGCGTAGACGGGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080853.3-2264s21c1
Sequence:CCGGCACTATGGTGGAGTCATATTTCTCGAGAAATATGACTCCACCATAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080853.3-1219s21c1
Sequence:CCGGCCAGATTCCAGGAGGATATATCTCGAGATATATCCTCCTGGAATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080853.3-2760s21c1
Sequence:CCGGCCGTCTTCATTCAGGCCATTTCTCGAGAAATGGCCTGAATGAAGACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020346
SLC17A6 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 17 (vesicular glutamate transporter), member 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-898s1c1
Sequence:CCGGCCTCTACCCTAAATATGCTAACTCGAGTTAGCATATTTAGGGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-1724s1c1
Sequence:CCGGCGCTCCAAGATATGCCAGTATCTCGAGATACTGGCATATCTTGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-2035s1c1
Sequence:CCGGCCAAGTCTTATGGTGCCACAACTCGAGTTGTGGCACCATAAGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-1475s1c1
Sequence:CCGGGCCACACTTAGTAATGACAATCTCGAGATTGTCATTACTAAGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-1344s1c1
Sequence:CCGGCCAGTCTATGCAATAATTGTTCTCGAGAACAATTATTGCATAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020346.2-1403s21c1
Sequence:CCGGTATTAGTCAGCCAGCATATTTCTCGAGAAATATGCTGGCTGACTAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020346.2-2120s21c1
Sequence:CCGGACAAGACTCACATAGCTATAACTCGAGTTATAGCTATGTGAGTCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020346.2-2581s21c1
Sequence:CCGGCGTCAAGTAGAGGCGACATTTCTCGAGAAATGTCGCCTCTACTTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020346.2-1783s21c1
Sequence:CCGGGAATGGTTTGTCCTATCATTGCTCGAGCAATGATAGGACAAACCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020346
SLC17A6 MISSION shRNA shRNA Plasmid DNA
solute carrier family 17 (vesicular glutamate transporter), member 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-898s1c1
Sequence:CCGGCCTCTACCCTAAATATGCTAACTCGAGTTAGCATATTTAGGGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-1724s1c1
Sequence:CCGGCGCTCCAAGATATGCCAGTATCTCGAGATACTGGCATATCTTGGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-2035s1c1
Sequence:CCGGCCAAGTCTTATGGTGCCACAACTCGAGTTGTGGCACCATAAGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-1475s1c1
Sequence:CCGGGCCACACTTAGTAATGACAATCTCGAGATTGTCATTACTAAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-1344s1c1
Sequence:CCGGCCAGTCTATGCAATAATTGTTCTCGAGAACAATTATTGCATAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020346.2-1403s21c1
Sequence:CCGGTATTAGTCAGCCAGCATATTTCTCGAGAAATATGCTGGCTGACTAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020346.2-2120s21c1
Sequence:CCGGACAAGACTCACATAGCTATAACTCGAGTTATAGCTATGTGAGTCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020346.2-2581s21c1
Sequence:CCGGCGTCAAGTAGAGGCGACATTTCTCGAGAAATGTCGCCTCTACTTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020346.2-1783s21c1
Sequence:CCGGGAATGGTTTGTCCTATCATTGCTCGAGCAATGATAGGACAAACCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020346
SLC17A6 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 17 (vesicular glutamate transporter), member 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-898s1c1
Sequence:CCGGCCTCTACCCTAAATATGCTAACTCGAGTTAGCATATTTAGGGTAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-1724s1c1
Sequence:CCGGCGCTCCAAGATATGCCAGTATCTCGAGATACTGGCATATCTTGGAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-2035s1c1
Sequence:CCGGCCAAGTCTTATGGTGCCACAACTCGAGTTGTGGCACCATAAGACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-1475s1c1
Sequence:CCGGGCCACACTTAGTAATGACAATCTCGAGATTGTCATTACTAAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020346.1-1344s1c1
Sequence:CCGGCCAGTCTATGCAATAATTGTTCTCGAGAACAATTATTGCATAGACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020346.2-1403s21c1
Sequence:CCGGTATTAGTCAGCCAGCATATTTCTCGAGAAATATGCTGGCTGACTAATATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020346.2-2120s21c1
Sequence:CCGGACAAGACTCACATAGCTATAACTCGAGTTATAGCTATGTGAGTCTTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020346.2-2581s21c1
Sequence:CCGGCGTCAAGTAGAGGCGACATTTCTCGAGAAATGTCGCCTCTACTTGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020346.2-1783s21c1
Sequence:CCGGGAATGGTTTGTCCTATCATTGCTCGAGCAATGATAGGACAAACCATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)