EMAIL THIS PAGE TO A FRIEND

SLC19A2

solute carrier family 19 (thiamine transporter), member 2

111 Gene Product Result for
Synonyms: TC1 THMD1 THT1 THTR1 TRMA
Gene ID:
Human(10560) Summary: This gene encodes the thiamin transporter protein. Mutations in this gene cause thiamin-responsive megaloblastic anemia syndrome (TRMA), which is an autosomal recessive disorder characterized by diabetes mellitus, megaloblastic anemia and sensorineural deafness. [provided by RefSeq, Jul 2008]
Mouse(116914) solute carrier family 19 (thiamine transporter), member 2
Rat(289175) solute carrier family 19 (thiamine transporter), member 2
Zebrafish(569085) solute carrier family 19 (thiamine transporter), member 2
Horse(100058457) solute carrier family 19 (thiamine transporter), member 2
chicken(427957) solute carrier family 19 (thiamine transporter), member 2
dog(490353) solute carrier family 19 (thiamine transporter), member 2
domestic cat(664737) solute carrier family 19 (thiamine transporter), member 2
cow(532860) solute carrier family 19 (thiamine transporter), member 2
sheep(101123393) solute carrier family 19 (thiamine transporter), member 2
naked mole-rat(101702163) solute carrier family 19 (thiamine transporter), member 2
domestic guinea pig(100717365) solute carrier family 19 (thiamine transporter), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006996 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_054087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014321 MISSION® esiRNA esiRNA targeting mouse Slc19a2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006996 Rosetta Predictions human pricing
NM_001030024 Rosetta Predictions rat pricing
NM_054087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207112 predicted 1675
2 SASI_Hs01_00207113 predicted 620
3 SASI_Hs01_00207114 predicted 482
4 SASI_Hs02_00342746 predicted 1244
5 SASI_Hs01_00207115 predicted 519
6 SASI_Hs01_00207116 predicted 1242
7 SASI_Hs01_00207117 predicted 686
8 SASI_Hs01_00207118 predicted 782
9 SASI_Hs01_00207119 predicted 615
10 SASI_Hs01_00207120 predicted 1683
11 SASI_Hs01_00207111 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030024 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049696 predicted 1359
2 SASI_Rn01_00049697 predicted 825
3 SASI_Rn01_00049698 predicted 1387
4 SASI_Rn01_00049699 predicted 570
5 SASI_Rn01_00049700 predicted 1695
6 SASI_Rn01_00049701 predicted 424
7 SASI_Rn01_00049702 predicted 1245
8 SASI_Rn02_00203529 predicted 529
9 SASI_Rn02_00203530 predicted 1537
10 SASI_Rn01_00049704 predicted 566
11 SASI_Rn01_00049703 predicted 1258
12 SASI_Rn01_00049705 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031873 predicted 1400
2 SASI_Mm01_00031874 predicted 1234
3 SASI_Mm01_00031875 predicted 1411
4 SASI_Mm01_00031876 predicted 829
5 SASI_Mm01_00031877 predicted 607
6 SASI_Mm01_00031879 predicted 748
7 SASI_Mm02_00338016 predicted 1029
8 SASI_Mm01_00031880 predicted 1542
9 SASI_Mm01_00031881 predicted 1421
10 SASI_Mm01_00031882 predicted 1119
11 SASI_Mm01_00031878 predicted 1481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006996
VALIDATED
SLC19A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 19 (thiamine transporter), member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-1060s1c1
Sequence:CCGGCGTCTCCTTGTATTGAAAGTACTCGAGTACTTTCAATACAAGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-1270s1c1
Sequence:CCGGGCTGTTGCTGTGTTTGCAGTTCTCGAGAACTGCAAACACAGCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-1709s1c1
Sequence:CCGGGTTCTCAAGTAACCACTTCATCTCGAGATGAAGTGGTTACTTGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006996.2-1027s21c1
Sequence:CCGGCGTCTCCTTGTATTGAAAGTACTCGAGTACTTTCAATACAAGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-1499s1c1
Sequence:CCGGCCCTAGTATTTGGTGTAAATACTCGAGTATTTACACCAAATACTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-642s1c1
Sequence:CCGGAGCCACTGAAATTGCCTATTACTCGAGTAATAGGCAATTTCAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006996.2-1676s21c1
Sequence:CCGGGTTCTCAAGTAACCACTTCATCTCGAGATGAAGTGGTTACTTGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006996.2-1466s21c1
Sequence:CCGGCCCTAGTATTTGGTGTAAATACTCGAGTATTTACACCAAATACTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006996.1-642s1c2
Sequence:CCGGAGCCACTGAAATTGCCTATTACTCGAGTAATAGGCAATTTCAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006996.2-609s21c1
Sequence:CCGGAGCCACTGAAATTGCCTATTACTCGAGTAATAGGCAATTTCAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006996
VALIDATED
SLC19A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 19 (thiamine transporter), member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-1060s1c1
Sequence:CCGGCGTCTCCTTGTATTGAAAGTACTCGAGTACTTTCAATACAAGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-1270s1c1
Sequence:CCGGGCTGTTGCTGTGTTTGCAGTTCTCGAGAACTGCAAACACAGCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-1709s1c1
Sequence:CCGGGTTCTCAAGTAACCACTTCATCTCGAGATGAAGTGGTTACTTGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006996.2-1027s21c1
Sequence:CCGGCGTCTCCTTGTATTGAAAGTACTCGAGTACTTTCAATACAAGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-1499s1c1
Sequence:CCGGCCCTAGTATTTGGTGTAAATACTCGAGTATTTACACCAAATACTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-642s1c1
Sequence:CCGGAGCCACTGAAATTGCCTATTACTCGAGTAATAGGCAATTTCAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006996.2-1676s21c1
Sequence:CCGGGTTCTCAAGTAACCACTTCATCTCGAGATGAAGTGGTTACTTGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006996.2-1466s21c1
Sequence:CCGGCCCTAGTATTTGGTGTAAATACTCGAGTATTTACACCAAATACTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006996.1-642s1c2
Sequence:CCGGAGCCACTGAAATTGCCTATTACTCGAGTAATAGGCAATTTCAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006996.2-609s21c1
Sequence:CCGGAGCCACTGAAATTGCCTATTACTCGAGTAATAGGCAATTTCAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006996
VALIDATED
SLC19A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 19 (thiamine transporter), member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-1060s1c1
Sequence:CCGGCGTCTCCTTGTATTGAAAGTACTCGAGTACTTTCAATACAAGGAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-1270s1c1
Sequence:CCGGGCTGTTGCTGTGTTTGCAGTTCTCGAGAACTGCAAACACAGCAACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-1709s1c1
Sequence:CCGGGTTCTCAAGTAACCACTTCATCTCGAGATGAAGTGGTTACTTGAGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006996.2-1027s21c1
Sequence:CCGGCGTCTCCTTGTATTGAAAGTACTCGAGTACTTTCAATACAAGGAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-1499s1c1
Sequence:CCGGCCCTAGTATTTGGTGTAAATACTCGAGTATTTACACCAAATACTAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006996.1-642s1c1
Sequence:CCGGAGCCACTGAAATTGCCTATTACTCGAGTAATAGGCAATTTCAGTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006996.2-1676s21c1
Sequence:CCGGGTTCTCAAGTAACCACTTCATCTCGAGATGAAGTGGTTACTTGAGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006996.2-1466s21c1
Sequence:CCGGCCCTAGTATTTGGTGTAAATACTCGAGTATTTACACCAAATACTAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006996.1-642s1c2
Sequence:CCGGAGCCACTGAAATTGCCTATTACTCGAGTAATAGGCAATTTCAGTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006996.2-609s21c1
Sequence:CCGGAGCCACTGAAATTGCCTATTACTCGAGTAATAGGCAATTTCAGTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054087
VALIDATED
SLC19A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 19 (thiamine transporter), member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-616s21c1
Sequence:CCGGGCCTACTACTCCTATATCTATCTCGAGATAGATATAGGAGTAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054087.1-1616s1c1
Sequence:CCGGCGAATGGCATAGTCAGTATTACTCGAGTAATACTGACTATGCCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054087.1-3369s1c1
Sequence:CCGGCGTGTCTAAATCAAGACTGTACTCGAGTACAGTCTTGATTTAGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054087.1-519s1c1
Sequence:CCGGCCTGATTGTGACGTGGTTCATCTCGAGATGAACCACGTCACAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054087.1-1122s1c1
Sequence:CCGGCGGCTATTTCCAAGTGGTGAACTCGAGTTCACCACTTGGAAATAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054087.1-616s1c1
Sequence:CCGGGCCTACTACTCCTATATCTATCTCGAGATAGATATAGGAGTAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-519s21c1
Sequence:CCGGCCTGATTGTGACGTGGTTCATCTCGAGATGAACCACGTCACAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-1408s21c1
Sequence:CCGGCTCATCACCATAGCAACTTTCCTCGAGGAAAGTTGCTATGGTGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-1243s21c1
Sequence:CCGGGTGTTTGCAGTTGGCTATATACTCGAGTATATAGCCAACTGCAAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-1122s21c1
Sequence:CCGGCGGCTATTTCCAAGTGGTGAACTCGAGTTCACCACTTGGAAATAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054087
VALIDATED
SLC19A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 19 (thiamine transporter), member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-616s21c1
Sequence:CCGGGCCTACTACTCCTATATCTATCTCGAGATAGATATAGGAGTAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054087.1-1616s1c1
Sequence:CCGGCGAATGGCATAGTCAGTATTACTCGAGTAATACTGACTATGCCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054087.1-3369s1c1
Sequence:CCGGCGTGTCTAAATCAAGACTGTACTCGAGTACAGTCTTGATTTAGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054087.1-519s1c1
Sequence:CCGGCCTGATTGTGACGTGGTTCATCTCGAGATGAACCACGTCACAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054087.1-1122s1c1
Sequence:CCGGCGGCTATTTCCAAGTGGTGAACTCGAGTTCACCACTTGGAAATAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054087.1-616s1c1
Sequence:CCGGGCCTACTACTCCTATATCTATCTCGAGATAGATATAGGAGTAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-519s21c1
Sequence:CCGGCCTGATTGTGACGTGGTTCATCTCGAGATGAACCACGTCACAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-1408s21c1
Sequence:CCGGCTCATCACCATAGCAACTTTCCTCGAGGAAAGTTGCTATGGTGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-1243s21c1
Sequence:CCGGGTGTTTGCAGTTGGCTATATACTCGAGTATATAGCCAACTGCAAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-1122s21c1
Sequence:CCGGCGGCTATTTCCAAGTGGTGAACTCGAGTTCACCACTTGGAAATAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054087
VALIDATED
SLC19A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 19 (thiamine transporter), member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-616s21c1
Sequence:CCGGGCCTACTACTCCTATATCTATCTCGAGATAGATATAGGAGTAGTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054087.1-1616s1c1
Sequence:CCGGCGAATGGCATAGTCAGTATTACTCGAGTAATACTGACTATGCCATTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054087.1-3369s1c1
Sequence:CCGGCGTGTCTAAATCAAGACTGTACTCGAGTACAGTCTTGATTTAGACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054087.1-519s1c1
Sequence:CCGGCCTGATTGTGACGTGGTTCATCTCGAGATGAACCACGTCACAATCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054087.1-1122s1c1
Sequence:CCGGCGGCTATTTCCAAGTGGTGAACTCGAGTTCACCACTTGGAAATAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054087.1-616s1c1
Sequence:CCGGGCCTACTACTCCTATATCTATCTCGAGATAGATATAGGAGTAGTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-519s21c1
Sequence:CCGGCCTGATTGTGACGTGGTTCATCTCGAGATGAACCACGTCACAATCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-1408s21c1
Sequence:CCGGCTCATCACCATAGCAACTTTCCTCGAGGAAAGTTGCTATGGTGATGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-1243s21c1
Sequence:CCGGGTGTTTGCAGTTGGCTATATACTCGAGTATATAGCCAACTGCAAACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054087.2-1122s21c1
Sequence:CCGGCGGCTATTTCCAAGTGGTGAACTCGAGTTCACCACTTGGAAATAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)