EMAIL THIS PAGE TO A FRIEND

SLC1A1

solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1

174 Gene Product Result for
Synonyms: EAAC1 EAAT3 SCZD18
UniProtKB ID: P43005, O75587, Q5VZ24, Q8N199, Q9UEW2
Gene ID:
Human(6505) Summary: This gene encodes a member of the high-affinity glutamate transporters that play an essential role in transporting glutamate across plasma membranes. In brain, these transporters are crucial in terminating the postsynaptic action of the neurotransmitter glutamate, and in maintaining extracellular glutamate concentrations below neurotoxic levels. This transporter also transports aspartate, and mutations in this gene are thought to cause dicarboxylicamino aciduria, also known as glutamate-aspartate transport defect. [provided by RefSeq, Mar 2010]
Mouse(20510) solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Rat(25550) solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Zebrafish(436939) solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
chicken(427352) solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
dog(403751) solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
domestic cat(101099844) solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
cow(282353) solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Domestic Rabbit(100009070) solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
naked mole-rat(101713753) solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
domestic guinea pig(100721255) solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA020086 Anti-EAAC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
AB1520 Anti-Glutamate Transporter Antibody, neuronal Anti-Glutamate Transporter Antibody, neuronal detects level of Glutamate Transporter & has been published & validated for use in IH. guinea pig, rat, mouse
immunohistochemistry pricing
MAB1587 Anti-Glutamate Transporter Antibody, neuronal, clone 4D6.2 Anti-Glutamate Transporter Antibody, neuronal, clone 4D6.2 is an antibody against Glutamate Transporter for use in IH & WB. rat
immunohistochemistry, western blot pricing
SAB2102170 Anti-SLC1A1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4200518 Anti-SLC1A1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB5200483 Monoclonal Anti-Eaac1 - Alkaline Phosphatase antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200484 Monoclonal Anti-Eaac1 - Apc antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200475 Monoclonal Anti-Eaac1 - Atto 390 antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200476 Monoclonal Anti-Eaac1 - Atto 488 antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200477 Monoclonal Anti-Eaac1 - Atto 565 antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200478 Monoclonal Anti-Eaac1 - Atto 594 antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200479 Monoclonal Anti-Eaac1 - Atto 633 antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200480 Monoclonal Anti-Eaac1 - Atto 655 antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200481 Monoclonal Anti-Eaac1 - Atto 680 antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200482 Monoclonal Anti-Eaac1 - Atto 700 antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200485 Monoclonal Anti-Eaac1 - Biotin antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200486 Monoclonal Anti-Eaac1 - Fitc antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200487 Monoclonal Anti-Eaac1 - Hrp antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200488 Monoclonal Anti-Eaac1 - Pe/Atto 594 antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200489 Monoclonal Anti-Eaac1 - Percp antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200490 Monoclonal Anti-Eaac1 - Rpe antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200491 Monoclonal Anti-Eaac1 - Streptavidin antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
SAB5200474 Monoclonal Anti-Eaac1 antibody produced in mouse clone S180-41, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004170 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039711 MISSION® esiRNA esiRNA human SLC1A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004170 Rosetta Predictions human pricing
NM_013032 Rosetta Predictions rat pricing
NM_009199 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146137 predicted 999
2 SASI_Hs01_00146138 predicted 1647
3 SASI_Hs01_00146139 predicted 1304
4 SASI_Hs01_00146140 predicted 841
5 SASI_Hs02_00337051 predicted 1842
6 SASI_Hs01_00146141 predicted 1702
7 SASI_Hs01_00146142 predicted 639
8 SASI_Hs01_00146143 predicted 539
9 SASI_Hs01_00146144 predicted 982
10 SASI_Hs01_00146145 predicted 437
11 SASI_Hs01_00146136 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069883 predicted 784
2 SASI_Rn01_00069884 predicted 1550
3 SASI_Rn01_00069885 predicted 411
4 SASI_Rn01_00069886 predicted 1014
5 SASI_Rn01_00069887 predicted 849
6 SASI_Rn01_00069888 predicted 388
7 SASI_Rn01_00069889 predicted 787
8 SASI_Rn02_00260725 predicted 837
9 SASI_Rn02_00260726 predicted 742
10 SASI_Rn02_00260727 predicted 285
11 SASI_Rn01_00069890 predicted 309
12 SASI_Rn01_00069891 predicted 703
13 SASI_Rn01_00069892 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166741 predicted 998
2 SASI_Mm01_00166742 predicted 201
3 SASI_Mm01_00166743 predicted 1047
4 SASI_Mm01_00166744 predicted 450
5 SASI_Mm01_00166745 predicted 1554
6 SASI_Mm01_00166746 predicted 1703
7 SASI_Mm01_00166747 predicted 373
8 SASI_Mm01_00166750 predicted 1740
9 SASI_Mm02_00315577 predicted 819
10 SASI_Mm02_00315578 predicted 1128
11 SASI_Mm01_00166748 predicted 926
12 SASI_Mm01_00166749 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004170
VALIDATED
SLC1A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-443s1c1
Sequence:CCGGGCCATTAATTATATCCAGCATCTCGAGATGCTGGATATAATTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-1319s1c1
Sequence:CCGGCGTTGGTGCAACAATCAACATCTCGAGATGTTGATTGTTGCACCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-548s1c1
Sequence:CCGGCATTGCTGTTATTCTAGGTATCTCGAGATACCTAGAATAACAGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-896s1c1
Sequence:CCGGCCTTGTCTTTGGACTTGTCATCTCGAGATGACAAGTCCAAAGACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-1038s1c1
Sequence:CCGGGCTGGGAAGATCATAGAAGTTCTCGAGAACTTCTATGATCTTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004170.4-3030s21c1
Sequence:CCGGAGAGTAAATCCCACGACATAACTCGAGTTATGTCGTGGGATTTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004170.4-1003s21c1
Sequence:CCGGGTTATATGCCACTAGGTATTTCTCGAGAAATACCTAGTGGCATATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004170.4-509s21c1
Sequence:CCGGTCTGCGCGCTGTCGTGTATTACTCGAGTAATACACGACAGCGCGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004170.4-418s21c1
Sequence:CCGGGGATGCTGAAACTCATCATTTCTCGAGAAATGATGAGTTTCAGCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004170.4-1131s21c1
Sequence:CCGGGTAATTCTCCCGCTGATATATCTCGAGATATATCAGCGGGAGAATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004170
VALIDATED
SLC1A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-443s1c1
Sequence:CCGGGCCATTAATTATATCCAGCATCTCGAGATGCTGGATATAATTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-1319s1c1
Sequence:CCGGCGTTGGTGCAACAATCAACATCTCGAGATGTTGATTGTTGCACCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-548s1c1
Sequence:CCGGCATTGCTGTTATTCTAGGTATCTCGAGATACCTAGAATAACAGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-896s1c1
Sequence:CCGGCCTTGTCTTTGGACTTGTCATCTCGAGATGACAAGTCCAAAGACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-1038s1c1
Sequence:CCGGGCTGGGAAGATCATAGAAGTTCTCGAGAACTTCTATGATCTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004170.4-3030s21c1
Sequence:CCGGAGAGTAAATCCCACGACATAACTCGAGTTATGTCGTGGGATTTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004170.4-1003s21c1
Sequence:CCGGGTTATATGCCACTAGGTATTTCTCGAGAAATACCTAGTGGCATATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004170.4-509s21c1
Sequence:CCGGTCTGCGCGCTGTCGTGTATTACTCGAGTAATACACGACAGCGCGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004170.4-418s21c1
Sequence:CCGGGGATGCTGAAACTCATCATTTCTCGAGAAATGATGAGTTTCAGCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004170.4-1131s21c1
Sequence:CCGGGTAATTCTCCCGCTGATATATCTCGAGATATATCAGCGGGAGAATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004170
VALIDATED
SLC1A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-443s1c1
Sequence:CCGGGCCATTAATTATATCCAGCATCTCGAGATGCTGGATATAATTAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-1319s1c1
Sequence:CCGGCGTTGGTGCAACAATCAACATCTCGAGATGTTGATTGTTGCACCAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-548s1c1
Sequence:CCGGCATTGCTGTTATTCTAGGTATCTCGAGATACCTAGAATAACAGCAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-896s1c1
Sequence:CCGGCCTTGTCTTTGGACTTGTCATCTCGAGATGACAAGTCCAAAGACAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004170.3-1038s1c1
Sequence:CCGGGCTGGGAAGATCATAGAAGTTCTCGAGAACTTCTATGATCTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004170.4-3030s21c1
Sequence:CCGGAGAGTAAATCCCACGACATAACTCGAGTTATGTCGTGGGATTTACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004170.4-1003s21c1
Sequence:CCGGGTTATATGCCACTAGGTATTTCTCGAGAAATACCTAGTGGCATATAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004170.4-509s21c1
Sequence:CCGGTCTGCGCGCTGTCGTGTATTACTCGAGTAATACACGACAGCGCGCAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004170.4-418s21c1
Sequence:CCGGGGATGCTGAAACTCATCATTTCTCGAGAAATGATGAGTTTCAGCATCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004170.4-1131s21c1
Sequence:CCGGGTAATTCTCCCGCTGATATATCTCGAGATATATCAGCGGGAGAATTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009199
SLC1A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009199.1-3447s1c1
Sequence:CCGGCCGAACTTTGAAGAAACAAATCTCGAGATTTGTTTCTTCAAAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009199.1-157s1c1
Sequence:CCGGCGTGGTACTAGGAATTGTCTTCTCGAGAAGACAATTCCTAGTACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009199.1-283s1c1
Sequence:CCGGGCTGATCGTATCCAGCATGATCTCGAGATCATGCTGGATACGATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009199.1-826s1c1
Sequence:CCGGCCAGATCATCATGTGCTACATCTCGAGATGTAGCACATGATGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009199.1-1207s1c1
Sequence:CCGGCGTGTTTATTGCGCAACTGAACTCGAGTTCAGTTGCGCAATAAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009199
SLC1A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009199.1-3447s1c1
Sequence:CCGGCCGAACTTTGAAGAAACAAATCTCGAGATTTGTTTCTTCAAAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009199.1-157s1c1
Sequence:CCGGCGTGGTACTAGGAATTGTCTTCTCGAGAAGACAATTCCTAGTACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009199.1-283s1c1
Sequence:CCGGGCTGATCGTATCCAGCATGATCTCGAGATCATGCTGGATACGATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009199.1-826s1c1
Sequence:CCGGCCAGATCATCATGTGCTACATCTCGAGATGTAGCACATGATGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009199.1-1207s1c1
Sequence:CCGGCGTGTTTATTGCGCAACTGAACTCGAGTTCAGTTGCGCAATAAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009199
SLC1A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009199.1-3447s1c1
Sequence:CCGGCCGAACTTTGAAGAAACAAATCTCGAGATTTGTTTCTTCAAAGTTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009199.1-157s1c1
Sequence:CCGGCGTGGTACTAGGAATTGTCTTCTCGAGAAGACAATTCCTAGTACCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009199.1-283s1c1
Sequence:CCGGGCTGATCGTATCCAGCATGATCTCGAGATCATGCTGGATACGATCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009199.1-826s1c1
Sequence:CCGGCCAGATCATCATGTGCTACATCTCGAGATGTAGCACATGATGATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009199.1-1207s1c1
Sequence:CCGGCGTGTTTATTGCGCAACTGAACTCGAGTTCAGTTGCGCAATAAACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)