EMAIL THIS PAGE TO A FRIEND

SLC1A2

solute carrier family 1 (glial high affinity glutamate transporter), member 2

439 Gene Product Result for
Synonyms: EAAT2 GLT-1
UniProtKB ID: P43004, Q14417, Q541G6
Gene ID:
Human(6506) Summary: This gene encodes a member of a family of solute transporter proteins. The membrane-bound protein is the principal transporter that clears the excitatory neurotransmitter glutamate from the extracellular space at synapses in the central nervous system. Glutamate clearance is necessary for proper synaptic activation and to prevent neuronal damage from excessive activation of glutamate receptors. Mutations in and decreased expression of this protein are associated with amyotrophic lateral sclerosis. Alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Sep 2010]
Mouse(20511) solute carrier family 1 (glial high affinity glutamate transporter), member 2
Rat(29482) solute carrier family 1 (glial high affinity glutamate transporter), member 2
domestic guinea pig(100731435) solute carrier family 1 (glial high affinity glutamate transporter), member 2
naked mole-rat(101701278) solute carrier family 1 (glial high affinity glutamate transporter), member 2
cow(541119) solute carrier family 1 (glial high affinity glutamate transporter), member 2
chicken(423156) solute carrier family 1 (glial high affinity glutamate transporter), member 2
dog(403750) solute carrier family 1 (glial high affinity glutamate transporter), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D1064 Dihydrokainic acid ≥98% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004171 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160131 MISSION® esiRNA esiRNA human SLC1A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004171 Rosetta Predictions human pricing
NM_001035233 Rosetta Predictions rat pricing
NM_017215 Rosetta Predictions rat pricing
NM_001077514 Rosetta Predictions mouse pricing
NM_001077515 Rosetta Predictions mouse pricing
NM_011393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109453 predicted 1776
2 SASI_Hs01_00109454 predicted 810
3 SASI_Hs01_00109455 predicted 901
4 SASI_Hs01_00109457 predicted 1103
5 SASI_Hs01_00109458 predicted 1685
6 SASI_Hs01_00109459 predicted 1314
7 SASI_Hs01_00109460 predicted 1215
8 SASI_Hs02_00337052 predicted 873
9 SASI_Hs01_00109461 predicted 2146
10 SASI_Hs02_00337053 predicted 1263
11 SASI_Hs01_00109452 predicted 574
12 SASI_Hs01_00109456 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062046 predicted 1374
2 SASI_Rn01_00062047 predicted 736
3 SASI_Rn02_00204182 predicted 1382
4 SASI_Rn01_00062049 predicted 930
5 SASI_Rn01_00062050 predicted 198
6 SASI_Rn01_00062051 predicted 806
7 SASI_Rn02_00204183 predicted 1292
8 SASI_Rn01_00062052 predicted 648
9 SASI_Rn01_00062055 predicted 836
10 SASI_Rn02_00204184 predicted 662
11 SASI_Rn01_00062048 predicted 398
12 SASI_Rn01_00062053 predicted 787
13 SASI_Rn01_00062054 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106060 predicted 1375
2 SASI_Rn01_00106061 predicted 733
3 SASI_Rn02_00261578 predicted 1383
4 SASI_Rn01_00106063 predicted 933
5 SASI_Rn01_00106064 predicted 197
6 SASI_Rn01_00106065 predicted 810
7 SASI_Rn02_00261579 predicted 1295
8 SASI_Rn01_00106066 predicted 642
9 SASI_Rn01_00106069 predicted 830
10 SASI_Rn02_00261580 predicted 666
11 SASI_Rn01_00106062 predicted 394
12 SASI_Rn01_00106067 predicted 781
13 SASI_Rn01_00106068 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292752 predicted 877
2 SASI_Mm02_00292753 predicted 912
3 SASI_Mm02_00292754 predicted 1555
4 SASI_Mm02_00292755 predicted 1546
5 SASI_Mm02_00292756 predicted 1031
6 SASI_Mm02_00292757 predicted 1081
7 SASI_Mm02_00292758 predicted 951
8 SASI_Mm02_00292759 predicted 1551
9 SASI_Mm02_00292760 predicted 1051
10 SASI_Mm02_00292761 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292762 predicted 299
2 SASI_Mm02_00292763 predicted 324
3 SASI_Mm02_00292764 predicted 966
4 SASI_Mm02_00292765 predicted 962
5 SASI_Mm02_00292766 predicted 439
6 SASI_Mm02_00292767 predicted 493
7 SASI_Mm02_00292768 predicted 369
8 SASI_Mm02_00292769 predicted 963
9 SASI_Mm02_00292770 predicted 465
10 SASI_Mm02_00292771 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029930 predicted 311
2 SASI_Mm02_00320582 predicted 336
3 SASI_Mm02_00320583 predicted 982
4 SASI_Mm02_00320584 predicted 973
5 SASI_Mm02_00320585 predicted 455
6 SASI_Mm01_00029936 predicted 508
7 SASI_Mm01_00029937 predicted 379
8 SASI_Mm02_00320586 predicted 981
9 SASI_Mm02_00320587 predicted 478
10 SASI_Mm02_00320588 predicted 977
11 SASI_Mm01_00029931 predicted 1137
12 SASI_Mm01_00029932 predicted 1303
13 SASI_Mm01_00029933 predicted 1465
14 SASI_Mm01_00029934 predicted 731
15 SASI_Mm01_00029935 predicted 240
16 SASI_Mm01_00029938 predicted 928
17 SASI_Mm01_00029939 predicted 938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004171
SLC1A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 1 (glial high affinity glutamate transporter), member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004171.3-2510s21c1
Sequence:CCGGTGCTTTATAACCGTCTAATTTCTCGAGAAATTAGACGGTTATAAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004171.3-2115s21c1
Sequence:CCGGATCGAGTGCATGAAGATATTGCTCGAGCAATATCTTCATGCACTCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-565s1c1
Sequence:CCGGCCCTCTAATCATCTCCAGCTTCTCGAGAAGCTGGAGATGATTAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-831s1c1
Sequence:CCGGCCTGCTTTCAACAGATTCAAACTCGAGTTTGAATCTGTTGAAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-1971s1c1
Sequence:CCGGGCAGTGTTGAGGAAGAACCTTCTCGAGAAGGTTCTTCCTCAACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-1867s1c1
Sequence:CCGGCCACAGGGAAAGCAACTCTAACTCGAGTTAGAGTTGCTTTCCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004171.3-1539s21c1
Sequence:CCGGACATGGTAACAGTGATCATAGCTCGAGCTATGATCACTGTTACCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-1506s1c1
Sequence:CCGGCCGCCATCTTTATAGCCCAAACTCGAGTTTGGGCTATAAAGATGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004171
SLC1A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 1 (glial high affinity glutamate transporter), member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004171.3-2510s21c1
Sequence:CCGGTGCTTTATAACCGTCTAATTTCTCGAGAAATTAGACGGTTATAAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004171.3-2115s21c1
Sequence:CCGGATCGAGTGCATGAAGATATTGCTCGAGCAATATCTTCATGCACTCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-565s1c1
Sequence:CCGGCCCTCTAATCATCTCCAGCTTCTCGAGAAGCTGGAGATGATTAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-831s1c1
Sequence:CCGGCCTGCTTTCAACAGATTCAAACTCGAGTTTGAATCTGTTGAAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-1971s1c1
Sequence:CCGGGCAGTGTTGAGGAAGAACCTTCTCGAGAAGGTTCTTCCTCAACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-1867s1c1
Sequence:CCGGCCACAGGGAAAGCAACTCTAACTCGAGTTAGAGTTGCTTTCCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004171.3-1539s21c1
Sequence:CCGGACATGGTAACAGTGATCATAGCTCGAGCTATGATCACTGTTACCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-1506s1c1
Sequence:CCGGCCGCCATCTTTATAGCCCAAACTCGAGTTTGGGCTATAAAGATGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004171
SLC1A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 1 (glial high affinity glutamate transporter), member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004171.3-2510s21c1
Sequence:CCGGTGCTTTATAACCGTCTAATTTCTCGAGAAATTAGACGGTTATAAAGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004171.3-2115s21c1
Sequence:CCGGATCGAGTGCATGAAGATATTGCTCGAGCAATATCTTCATGCACTCGATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-565s1c1
Sequence:CCGGCCCTCTAATCATCTCCAGCTTCTCGAGAAGCTGGAGATGATTAGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-831s1c1
Sequence:CCGGCCTGCTTTCAACAGATTCAAACTCGAGTTTGAATCTGTTGAAAGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-1971s1c1
Sequence:CCGGGCAGTGTTGAGGAAGAACCTTCTCGAGAAGGTTCTTCCTCAACACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-1867s1c1
Sequence:CCGGCCACAGGGAAAGCAACTCTAACTCGAGTTAGAGTTGCTTTCCCTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004171.3-1539s21c1
Sequence:CCGGACATGGTAACAGTGATCATAGCTCGAGCTATGATCACTGTTACCATGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004171.2-1506s1c1
Sequence:CCGGCCGCCATCTTTATAGCCCAAACTCGAGTTTGGGCTATAAAGATGGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011393
SLC1A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 1 (glial high affinity glutamate transporter), member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011393.1-1643s1c1
Sequence:CCGGCGCACACAACTCTGTCGTAATCTCGAGATTACGACAGAGTTGTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011393.1-1917s1c1
Sequence:CCGGCCCTCTAATTTGGTCAATATTCTCGAGAATATTGACCAAATTAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011393.1-1583s1c1
Sequence:CCGGGCAGTCCATTTACGACGACAACTCGAGTTGTCGTCGTAAATGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011393.1-1644s1c1
Sequence:CCGGGCACACAACTCTGTCGTAATACTCGAGTATTACGACAGAGTTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011393.1-311s1c1
Sequence:CCGGCCCTCTTATCATCTCCAGTTTCTCGAGAAACTGGAGATGATAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011393
SLC1A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 1 (glial high affinity glutamate transporter), member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011393.1-1643s1c1
Sequence:CCGGCGCACACAACTCTGTCGTAATCTCGAGATTACGACAGAGTTGTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011393.1-1917s1c1
Sequence:CCGGCCCTCTAATTTGGTCAATATTCTCGAGAATATTGACCAAATTAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011393.1-1583s1c1
Sequence:CCGGGCAGTCCATTTACGACGACAACTCGAGTTGTCGTCGTAAATGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011393.1-1644s1c1
Sequence:CCGGGCACACAACTCTGTCGTAATACTCGAGTATTACGACAGAGTTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011393.1-311s1c1
Sequence:CCGGCCCTCTTATCATCTCCAGTTTCTCGAGAAACTGGAGATGATAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011393
SLC1A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 1 (glial high affinity glutamate transporter), member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011393.1-1643s1c1
Sequence:CCGGCGCACACAACTCTGTCGTAATCTCGAGATTACGACAGAGTTGTGTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011393.1-1917s1c1
Sequence:CCGGCCCTCTAATTTGGTCAATATTCTCGAGAATATTGACCAAATTAGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011393.1-1583s1c1
Sequence:CCGGGCAGTCCATTTACGACGACAACTCGAGTTGTCGTCGTAAATGGACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011393.1-1644s1c1
Sequence:CCGGGCACACAACTCTGTCGTAATACTCGAGTATTACGACAGAGTTGTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011393.1-311s1c1
Sequence:CCGGCCCTCTTATCATCTCCAGTTTCTCGAGAAACTGGAGATGATAAGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)