EMAIL THIS PAGE TO A FRIEND

SLC1A3

solute carrier family 1 (glial high affinity glutamate transporter), member 3

110 Gene Product Result for
Synonyms: EA6 EAAT1 GLAST GLAST1
UniProtKB ID: P43003, B2R5T3, Q4JCQ8
Gene ID:
Human(6507) Summary: This gene encodes a member of a member of a high affinity glutamate transporter family. Mutations in this gene are associated with episodic ataxia, Type 6. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
Mouse(20512) solute carrier family 1 (glial high affinity glutamate transporter), member 3
Rat(29483) solute carrier family 1 (glial high affinity glutamate transporter), member 3
chicken(395443) solute carrier family 1 (glial high affinity glutamate transporter), member 3
domestic cat(101098606) solute carrier family 1 (glial high affinity glutamate transporter), member 3
Horse(100053647) solute carrier family 1 (glial high affinity glutamate transporter), member 3
dog(403748) solute carrier family 1 (glial high affinity glutamate transporter), member 3
cow(282354) solute carrier family 1 (glial high affinity glutamate transporter), member 3
naked mole-rat(101703725) solute carrier family 1 (glial high affinity glutamate transporter), member 3
domestic guinea pig(100713011) solute carrier family 1 (glial high affinity glutamate transporter), member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148938 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148938 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148938 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004172 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004172 Rosetta Predictions human pricing
NM_019225 Rosetta Predictions rat pricing
NM_148938 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046509 predicted 1276
2 SASI_Hs01_00046510 predicted 1133
3 SASI_Hs01_00046511 predicted 2086
4 SASI_Hs01_00046512 predicted 653
5 SASI_Hs01_00046513 predicted 2036
6 SASI_Hs01_00046514 predicted 648
7 SASI_Hs02_00337054 predicted 1418
8 SASI_Hs01_00046515 predicted 809
9 SASI_Hs01_00046516 predicted 1458
10 SASI_Hs01_00046517 predicted 767
11 SASI_Hs01_00046508 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262083 predicted 365
2 SASI_Rn01_00111329 predicted 1031
3 SASI_Rn02_00262084 predicted 607
4 SASI_Rn01_00111330 predicted 1734
5 SASI_Rn01_00111331 predicted 1603
6 SASI_Rn01_00111332 predicted 1767
7 SASI_Rn01_00111334 predicted 1092
8 SASI_Rn01_00111335 predicted 739
9 SASI_Rn01_00111336 predicted 1447
10 SASI_Rn01_00111337 predicted 998
11 SASI_Rn01_00111333 predicted 319
12 SASI_Rn01_00111338 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092392 predicted 1427
2 SASI_Mm01_00092393 predicted 604
3 SASI_Mm01_00092394 predicted 1890
4 SASI_Mm01_00092395 predicted 1988
5 SASI_Mm01_00092396 predicted 1326
6 SASI_Mm01_00092397 predicted 2019
7 SASI_Mm01_00092398 predicted 2152
8 SASI_Mm01_00092399 predicted 1027
9 SASI_Mm01_00092400 predicted 2044
10 SASI_Mm01_00092401 predicted 1749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148938
SLC1A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 1 (glial high affinity glutamate transporter), member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009922    
Product Details

Region:5UTR
TRC Version: 1 Clone ID:NM_148938.x-261s1c1
Sequence:CCGGATTTGCCCTCCGACCGTATAACTCGAGTTATACGGTCGGAGGGCAAATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148938.3-965s21c1
Sequence:CCGGTGCTGTGGTGATTGGCATAATCTCGAGATTATGCCAATCACCACAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148938.x-815s1c1
Sequence:CCGGCCATGTGCTTCGGTTTCGTGACTCGAGTCACGAAACCGAAGCACATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148938.3-2601s21c1
Sequence:CCGGACAACTTGATGAGCAATTATCCTCGAGGATAATTGCTCATCAAGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148938.3-2440s21c1
Sequence:CCGGGTTTCGATATTACCAATTTAGCTCGAGCTAAATTGGTAATATCGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148938
SLC1A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 1 (glial high affinity glutamate transporter), member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009922    
Product Details

Region:5UTR
TRC Version: 1 Clone ID:NM_148938.x-261s1c1
Sequence:CCGGATTTGCCCTCCGACCGTATAACTCGAGTTATACGGTCGGAGGGCAAATTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000414023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148938.3-965s21c1
Sequence:CCGGTGCTGTGGTGATTGGCATAATCTCGAGATTATGCCAATCACCACAGCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000009924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148938.x-815s1c1
Sequence:CCGGCCATGTGCTTCGGTTTCGTGACTCGAGTCACGAAACCGAAGCACATGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000420349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148938.3-2601s21c1
Sequence:CCGGACAACTTGATGAGCAATTATCCTCGAGGATAATTGCTCATCAAGTTGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000431155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148938.3-2440s21c1
Sequence:CCGGGTTTCGATATTACCAATTTAGCTCGAGCTAAATTGGTAATATCGAAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148938
SLC1A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 1 (glial high affinity glutamate transporter), member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009922    
Product Details

Region:5UTR
TRC Version: 1 Clone ID:NM_148938.x-261s1c1
Sequence:CCGGATTTGCCCTCCGACCGTATAACTCGAGTTATACGGTCGGAGGGCAAATTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148938.3-965s21c1
Sequence:CCGGTGCTGTGGTGATTGGCATAATCTCGAGATTATGCCAATCACCACAGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148938.x-815s1c1
Sequence:CCGGCCATGTGCTTCGGTTTCGTGACTCGAGTCACGAAACCGAAGCACATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148938.3-2601s21c1
Sequence:CCGGACAACTTGATGAGCAATTATCCTCGAGGATAATTGCTCATCAAGTTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148938.3-2440s21c1
Sequence:CCGGGTTTCGATATTACCAATTTAGCTCGAGCTAAATTGGTAATATCGAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004172
SLC1A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 1 (glial high affinity glutamate transporter), member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-1244s1c1
Sequence:CCGGCCACTCCTCTACTTCTTGGTACTCGAGTACCAAGAAGTAGAGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-607s1c1
Sequence:CCGGGCGAGCTGTAGTCTATTATATCTCGAGATATAATAGACTACAGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-1852s1c1
Sequence:CCGGCGACAGTGAAACCAAGATGTACTCGAGTACATCTTGGTTTCACTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-797s1c1
Sequence:CCGGGCCTGCTTTAAACAGTTTAAACTCGAGTTTAAACTGTTTAAAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-448s1c1
Sequence:CCGGCCGACCATACAGAATGAGCTACTCGAGTAGCTCATTCTGTATGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004172.4-2386s21c1
Sequence:CCGGTGTGGCACACAATCCTATAAACTCGAGTTTATAGGATTGTGTGCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004172.4-1733s21c1
Sequence:CCGGTGAACTGAACTTCGGACAAATCTCGAGATTTGTCCGAAGTTCAGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004172.4-2322s21c1
Sequence:CCGGATGTTAGTCTTACCGAATAAGCTCGAGCTTATTCGGTAAGACTAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004172
SLC1A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 1 (glial high affinity glutamate transporter), member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-1244s1c1
Sequence:CCGGCCACTCCTCTACTTCTTGGTACTCGAGTACCAAGAAGTAGAGGAGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000043197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-607s1c1
Sequence:CCGGGCGAGCTGTAGTCTATTATATCTCGAGATATAATAGACTACAGCTCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000043193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-1852s1c1
Sequence:CCGGCGACAGTGAAACCAAGATGTACTCGAGTACATCTTGGTTTCACTGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000043195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-797s1c1
Sequence:CCGGGCCTGCTTTAAACAGTTTAAACTCGAGTTTAAACTGTTTAAAGCAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000043194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-448s1c1
Sequence:CCGGCCGACCATACAGAATGAGCTACTCGAGTAGCTCATTCTGTATGGTCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000434047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004172.4-2386s21c1
Sequence:CCGGTGTGGCACACAATCCTATAAACTCGAGTTTATAGGATTGTGTGCCACATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000431078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004172.4-1733s21c1
Sequence:CCGGTGAACTGAACTTCGGACAAATCTCGAGATTTGTCCGAAGTTCAGTTCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000421606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004172.4-2322s21c1
Sequence:CCGGATGTTAGTCTTACCGAATAAGCTCGAGCTTATTCGGTAAGACTAACATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004172
SLC1A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 1 (glial high affinity glutamate transporter), member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-1244s1c1
Sequence:CCGGCCACTCCTCTACTTCTTGGTACTCGAGTACCAAGAAGTAGAGGAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-607s1c1
Sequence:CCGGGCGAGCTGTAGTCTATTATATCTCGAGATATAATAGACTACAGCTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-1852s1c1
Sequence:CCGGCGACAGTGAAACCAAGATGTACTCGAGTACATCTTGGTTTCACTGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-797s1c1
Sequence:CCGGGCCTGCTTTAAACAGTTTAAACTCGAGTTTAAACTGTTTAAAGCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004172.3-448s1c1
Sequence:CCGGCCGACCATACAGAATGAGCTACTCGAGTAGCTCATTCTGTATGGTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004172.4-2386s21c1
Sequence:CCGGTGTGGCACACAATCCTATAAACTCGAGTTTATAGGATTGTGTGCCACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004172.4-1733s21c1
Sequence:CCGGTGAACTGAACTTCGGACAAATCTCGAGATTTGTCCGAAGTTCAGTTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004172.4-2322s21c1
Sequence:CCGGATGTTAGTCTTACCGAATAAGCTCGAGCTTATTCGGTAAGACTAACATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)