EMAIL THIS PAGE TO A FRIEND

SLC22A2

solute carrier family 22 (organic cation transporter), member 2

71 Gene Product Result for
Synonyms: OCT2
UniProtKB ID: O15244, Q5T7Q6, Q6PIQ8, Q8NG62, Q9NQB9
Gene ID:
Human(6582) Summary: Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. It is found primarily in the kidney, where it may mediate the first step in cation reabsorption. [provided by RefSeq, Jul 2008]
Mouse(20518) solute carrier family 22 (organic cation transporter), member 2
Rat(29503) solute carrier family 22 (organic cation transporter), member 2
cow(521027) solute carrier family 22 (organic cation transporter), member 2
sheep(101111810) solute carrier family 22 (organic cation transporter), member 2
naked mole-rat(101705648) solute carrier family 22 (organic cation transporter), member 2
Domestic Rabbit(100008831) solute carrier family 22 (organic cation transporter), member 2
domestic guinea pig(100725634) solute carrier family 22 (organic cation transporter), member 2
Zebrafish(406424) solute carrier family 22 (organic cation transporter), member 2
dog(403655) solute carrier family 22 (organic cation transporter), member 2
domestic cat(101095017) solute carrier family 22 (organic cation transporter), member 2
chicken(421583) solute carrier family 22 (organic cation transporter), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003058 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017241 MISSION® esiRNA esiRNA targeting human SLC22A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003058 Rosetta Predictions human pricing
NM_153191 Rosetta Predictions human pricing
NM_031584 Rosetta Predictions rat pricing
NM_013667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172462 predicted 761
2 SASI_Hs01_00172463 predicted 708
3 SASI_Hs01_00172465 predicted 265
4 SASI_Hs01_00172466 predicted 1196
5 SASI_Hs01_00172467 predicted 845
6 SASI_Hs01_00172468 predicted 824
7 SASI_Hs01_00172469 predicted 603
8 SASI_Hs01_00172470 predicted 1714
9 SASI_Hs02_00334970 predicted 652
10 SASI_Hs02_00334971 predicted 1151
11 SASI_Hs01_00172461 predicted 723
12 SASI_Hs01_00172464 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156751 predicted 705
2 SASI_Hs01_00156752 predicted 1210
3 SASI_Hs01_00156753 predicted 633
4 SASI_Hs01_00156754 predicted 679
5 SASI_Hs01_00156755 predicted 1159
6 SASI_Hs01_00156756 predicted 279
7 SASI_Hs01_00156757 predicted 1199
8 SASI_Hs01_00156758 predicted 625
9 SASI_Hs01_00156759 predicted 661
10 SASI_Hs01_00156760 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064982 predicted 1384
2 SASI_Rn01_00064983 predicted 533
3 SASI_Rn01_00064984 predicted 1429
4 SASI_Rn01_00064985 predicted 585
5 SASI_Rn01_00064986 predicted 570
6 SASI_Rn01_00064987 predicted 944
7 SASI_Rn01_00064988 predicted 683
8 SASI_Rn01_00064989 predicted 693
9 SASI_Rn01_00064990 predicted 750
10 SASI_Rn02_00264850 predicted 1124
11 SASI_Rn01_00064991 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154834 predicted 1431
2 SASI_Mm01_00154835 predicted 818
3 SASI_Mm01_00154836 predicted 705
4 SASI_Mm01_00154837 predicted 1208
5 SASI_Mm01_00154838 predicted 689
6 SASI_Mm02_00322502 predicted 729
7 SASI_Mm01_00154839 predicted 752
8 SASI_Mm01_00154840 predicted 681
9 SASI_Mm01_00154841 predicted 942
10 SASI_Mm01_00154842 predicted 540
11 SASI_Mm01_00154843 predicted 1091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013667
SLC22A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 22 (organic cation transporter), member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-536s1c1
Sequence:CCGGGCTGGACCTGTTTCAGTCATTCTCGAGAATGACTGAAACAGGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-1417s1c1
Sequence:CCGGGCATCACCATAGCCTACGAAACTCGAGTTTCGTAGGCTATGGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-1467s1c1
Sequence:CCGGCCCACATACATCAGGAATCTTCTCGAGAAGATTCCTGATGTATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-793s1c1
Sequence:CCGGGCAGAACAGTAGGGATTTGTTCTCGAGAACAAATCCCTACTGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-739s1c1
Sequence:CCGGCGGGCTGGTTAATTGGCTATACTCGAGTATAGCCAATTAACCAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013667
SLC22A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 22 (organic cation transporter), member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-536s1c1
Sequence:CCGGGCTGGACCTGTTTCAGTCATTCTCGAGAATGACTGAAACAGGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-1417s1c1
Sequence:CCGGGCATCACCATAGCCTACGAAACTCGAGTTTCGTAGGCTATGGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-1467s1c1
Sequence:CCGGCCCACATACATCAGGAATCTTCTCGAGAAGATTCCTGATGTATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-793s1c1
Sequence:CCGGGCAGAACAGTAGGGATTTGTTCTCGAGAACAAATCCCTACTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-739s1c1
Sequence:CCGGCGGGCTGGTTAATTGGCTATACTCGAGTATAGCCAATTAACCAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013667
SLC22A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 22 (organic cation transporter), member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-536s1c1
Sequence:CCGGGCTGGACCTGTTTCAGTCATTCTCGAGAATGACTGAAACAGGTCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-1417s1c1
Sequence:CCGGGCATCACCATAGCCTACGAAACTCGAGTTTCGTAGGCTATGGTGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-1467s1c1
Sequence:CCGGCCCACATACATCAGGAATCTTCTCGAGAAGATTCCTGATGTATGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-793s1c1
Sequence:CCGGGCAGAACAGTAGGGATTTGTTCTCGAGAACAAATCCCTACTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013667.1-739s1c1
Sequence:CCGGCGGGCTGGTTAATTGGCTATACTCGAGTATAGCCAATTAACCAGCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003058
SLC22A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 22 (organic cation transporter), member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-1805s1c1
Sequence:CCGGCCAAGTTCAGAAACTAGACATCTCGAGATGTCTAGTTTCTGAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003058.2-849s21c1
Sequence:CCGGGAATTTGTTGGGCGGAGATATCTCGAGATATCTCCGCCCAACAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003058.2-605s21c1
Sequence:CCGGCTCCTGGATGTTGGACCTATTCTCGAGAATAGGTCCAACATCCAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-1545s1c1
Sequence:CCGGCCCACATTCATTAGGAATCTTCTCGAGAAGATTCCTAATGAATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-761s1c1
Sequence:CCGGCCCAACCTATACGTGGATGTTCTCGAGAACATCCACGTATAGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-707s1c1
Sequence:CCGGCCTCCTAACTACAGTCCTCATCTCGAGATGAGGACTGTAGTTAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-1153s1c1
Sequence:CCGGGCAAGAAATTGAACCCTTCATCTCGAGATGAAGGGTTCAATTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003058
SLC22A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 22 (organic cation transporter), member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-1805s1c1
Sequence:CCGGCCAAGTTCAGAAACTAGACATCTCGAGATGTCTAGTTTCTGAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003058.2-849s21c1
Sequence:CCGGGAATTTGTTGGGCGGAGATATCTCGAGATATCTCCGCCCAACAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003058.2-605s21c1
Sequence:CCGGCTCCTGGATGTTGGACCTATTCTCGAGAATAGGTCCAACATCCAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-1545s1c1
Sequence:CCGGCCCACATTCATTAGGAATCTTCTCGAGAAGATTCCTAATGAATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-761s1c1
Sequence:CCGGCCCAACCTATACGTGGATGTTCTCGAGAACATCCACGTATAGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-707s1c1
Sequence:CCGGCCTCCTAACTACAGTCCTCATCTCGAGATGAGGACTGTAGTTAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-1153s1c1
Sequence:CCGGGCAAGAAATTGAACCCTTCATCTCGAGATGAAGGGTTCAATTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003058
SLC22A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 22 (organic cation transporter), member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-1805s1c1
Sequence:CCGGCCAAGTTCAGAAACTAGACATCTCGAGATGTCTAGTTTCTGAACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003058.2-849s21c1
Sequence:CCGGGAATTTGTTGGGCGGAGATATCTCGAGATATCTCCGCCCAACAAATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003058.2-605s21c1
Sequence:CCGGCTCCTGGATGTTGGACCTATTCTCGAGAATAGGTCCAACATCCAGGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-1545s1c1
Sequence:CCGGCCCACATTCATTAGGAATCTTCTCGAGAAGATTCCTAATGAATGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-761s1c1
Sequence:CCGGCCCAACCTATACGTGGATGTTCTCGAGAACATCCACGTATAGGTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-707s1c1
Sequence:CCGGCCTCCTAACTACAGTCCTCATCTCGAGATGAGGACTGTAGTTAGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003058.2-1153s1c1
Sequence:CCGGGCAAGAAATTGAACCCTTCATCTCGAGATGAAGGGTTCAATTTCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)