EMAIL THIS PAGE TO A FRIEND

SLC22A3

solute carrier family 22 (organic cation transporter), member 3

59 Gene Product Result for
Synonyms: EMT EMTH OCT3
UniProtKB ID: O75751, Q5SYN6, Q9UP02
Gene ID:
Human(6581) Summary: Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. [provided by RefSeq, Jul 2008]
Mouse(20519) solute carrier family 22 (organic cation transporter), member 3
Rat(29504) solute carrier family 22 (organic cation transporter), member 3
cow(535665) solute carrier family 22 (organic cation transporter), member 3
sheep(100642179) solute carrier family 22 (extraneuronal monoamine transporter), member 3
naked mole-rat(101704450) solute carrier family 22 (extraneuronal monoamine transporter), member 3
chicken(421582) solute carrier family 22 (extraneuronal monoamine transporter), member 3
Horse(100058287) solute carrier family 22 (extraneuronal monoamine transporter), member 3
domestic cat(101097728) solute carrier family 22 (extraneuronal monoamine transporter), member 3
dog(476261) solute carrier family 22 (extraneuronal monoamine transporter), member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021977 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021977 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021977 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021977 Rosetta Predictions human pricing
NM_019230 Rosetta Predictions rat pricing
NM_011395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236321 predicted 1647
2 SASI_Hs01_00236322 predicted 1415
3 SASI_Hs01_00236323 predicted 1002
4 SASI_Hs01_00236324 predicted 1402
5 SASI_Hs01_00236325 predicted 920
6 SASI_Hs01_00236327 predicted 1312
7 SASI_Hs01_00236328 predicted 1645
8 SASI_Hs01_00236329 predicted 1307
9 SASI_Hs01_00236330 predicted 749
10 SASI_Hs02_00355332 predicted 918
11 SASI_Hs01_00236326 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114993 predicted 2136
2 SASI_Rn01_00114994 predicted 1189
3 SASI_Rn01_00114995 predicted 2025
4 SASI_Rn01_00114996 predicted 1700
5 SASI_Rn01_00114997 predicted 2071
6 SASI_Rn01_00114998 predicted 1314
7 SASI_Rn01_00114999 predicted 1744
8 SASI_Rn01_00115000 predicted 1430
9 SASI_Rn02_00262087 predicted 1059
10 SASI_Rn01_00115001 predicted 1866
11 SASI_Rn01_00115002 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129025 predicted 1368
2 SASI_Mm01_00129026 predicted 1738
3 SASI_Mm01_00129028 predicted 1265
4 SASI_Mm01_00129029 predicted 1054
5 SASI_Mm01_00129030 predicted 1545
6 SASI_Mm02_00320592 predicted 1692
7 SASI_Mm01_00129032 predicted 1825
8 SASI_Mm01_00129033 predicted 1981
9 SASI_Mm01_00129034 predicted 1327
10 SASI_Mm02_00320593 predicted 1405
11 SASI_Mm01_00129027 predicted 1704
12 SASI_Mm01_00129031 predicted 1848
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011395
SLC22A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 22 (organic cation transporter), member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-1322s1c1
Sequence:CCGGCTCATCAAATTACTCAGAGATCTCGAGATCTCTGAGTAATTTGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-1042s1c1
Sequence:CCGGGCTTCGTGATCGTGACAGAAACTCGAGTTTCTGTCACGATCACGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-1749s1c1
Sequence:CCGGCCAACGACATTACGGAACTTTCTCGAGAAAGTTCCGTAATGTCGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-905s1c1
Sequence:CCGGCAGGCTCATCATTTACTTAATCTCGAGATTAAGTAAATGATGAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-1417s1c1
Sequence:CCGGCGCTCATCCTTATGTTTGCTTCTCGAGAAGCAAACATAAGGATGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011395
SLC22A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 22 (organic cation transporter), member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-1322s1c1
Sequence:CCGGCTCATCAAATTACTCAGAGATCTCGAGATCTCTGAGTAATTTGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-1042s1c1
Sequence:CCGGGCTTCGTGATCGTGACAGAAACTCGAGTTTCTGTCACGATCACGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-1749s1c1
Sequence:CCGGCCAACGACATTACGGAACTTTCTCGAGAAAGTTCCGTAATGTCGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-905s1c1
Sequence:CCGGCAGGCTCATCATTTACTTAATCTCGAGATTAAGTAAATGATGAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-1417s1c1
Sequence:CCGGCGCTCATCCTTATGTTTGCTTCTCGAGAAGCAAACATAAGGATGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011395
SLC22A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 22 (organic cation transporter), member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-1322s1c1
Sequence:CCGGCTCATCAAATTACTCAGAGATCTCGAGATCTCTGAGTAATTTGATGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-1042s1c1
Sequence:CCGGGCTTCGTGATCGTGACAGAAACTCGAGTTTCTGTCACGATCACGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-1749s1c1
Sequence:CCGGCCAACGACATTACGGAACTTTCTCGAGAAAGTTCCGTAATGTCGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-905s1c1
Sequence:CCGGCAGGCTCATCATTTACTTAATCTCGAGATTAAGTAAATGATGAGCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011395.1-1417s1c1
Sequence:CCGGCGCTCATCCTTATGTTTGCTTCTCGAGAAGCAAACATAAGGATGAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021977
SLC22A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 22 (organic cation transporter), member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021977.2-560s21c1
Sequence:CCGGGGTATGGCAGGATCGTCATTTCTCGAGAAATGACGATCCTGCCATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-1410s1c1
Sequence:CCGGCCCAACAACATTACGAAATTTCTCGAGAAATTTCGTAATGTTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-798s1c1
Sequence:CCGGCCCTGGAATTGCCTACTTCATCTCGAGATGAAGTAGGCAATTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-1646s1c1
Sequence:CCGGCCTGTAAATGTGGCAGGAATACTCGAGTATTCCTGCCACATTTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-631s1c1
Sequence:CCGGGCACCAAACTTCCCTGTGTTTCTCGAGAAACACAGGGAAGTTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-1111s1c1
Sequence:CCGGGCAGTGGTGTATCAAGGACTTCTCGAGAAGTCCTTGATACACCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021977.2-775s21c1
Sequence:CCCGTTTACCCTTGGAATCATAATTCTCGAGAATTATGATTCCAAGGGTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021977.2-746s21c1
Sequence:CCGGGGATTGTGGGAATCGTGATTCCTCGAGGAATCACGATTCCCACAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021977.2-661s21c1
Sequence:CCGGCGCTTCCTGCAAGGTGTATTTCTCGAGAAATACACCTTGCAGGAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021977
SLC22A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 22 (organic cation transporter), member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021977.2-560s21c1
Sequence:CCGGGGTATGGCAGGATCGTCATTTCTCGAGAAATGACGATCCTGCCATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-1410s1c1
Sequence:CCGGCCCAACAACATTACGAAATTTCTCGAGAAATTTCGTAATGTTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-798s1c1
Sequence:CCGGCCCTGGAATTGCCTACTTCATCTCGAGATGAAGTAGGCAATTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-1646s1c1
Sequence:CCGGCCTGTAAATGTGGCAGGAATACTCGAGTATTCCTGCCACATTTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-631s1c1
Sequence:CCGGGCACCAAACTTCCCTGTGTTTCTCGAGAAACACAGGGAAGTTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-1111s1c1
Sequence:CCGGGCAGTGGTGTATCAAGGACTTCTCGAGAAGTCCTTGATACACCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021977.2-775s21c1
Sequence:CCCGTTTACCCTTGGAATCATAATTCTCGAGAATTATGATTCCAAGGGTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021977.2-746s21c1
Sequence:CCGGGGATTGTGGGAATCGTGATTCCTCGAGGAATCACGATTCCCACAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021977.2-661s21c1
Sequence:CCGGCGCTTCCTGCAAGGTGTATTTCTCGAGAAATACACCTTGCAGGAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021977
SLC22A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 22 (organic cation transporter), member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021977.2-560s21c1
Sequence:CCGGGGTATGGCAGGATCGTCATTTCTCGAGAAATGACGATCCTGCCATACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-1410s1c1
Sequence:CCGGCCCAACAACATTACGAAATTTCTCGAGAAATTTCGTAATGTTGTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-798s1c1
Sequence:CCGGCCCTGGAATTGCCTACTTCATCTCGAGATGAAGTAGGCAATTCCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-1646s1c1
Sequence:CCGGCCTGTAAATGTGGCAGGAATACTCGAGTATTCCTGCCACATTTACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-631s1c1
Sequence:CCGGGCACCAAACTTCCCTGTGTTTCTCGAGAAACACAGGGAAGTTTGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021977.2-1111s1c1
Sequence:CCGGGCAGTGGTGTATCAAGGACTTCTCGAGAAGTCCTTGATACACCACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021977.2-775s21c1
Sequence:CCCGTTTACCCTTGGAATCATAATTCTCGAGAATTATGATTCCAAGGGTAAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021977.2-746s21c1
Sequence:CCGGGGATTGTGGGAATCGTGATTCCTCGAGGAATCACGATTCCCACAATCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021977.2-661s21c1
Sequence:CCGGCGCTTCCTGCAAGGTGTATTTCTCGAGAAATACACCTTGCAGGAAGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)