EMAIL THIS PAGE TO A FRIEND

SLC23A2

solute carrier family 23 (ascorbic acid transporter), member 2

76 Gene Product Result for
Synonyms: NBTL1 SLC23A1 SVCT2 YSPL2
UniProtKB ID: Q9UGH3, Q8WWR4, Q92512, Q96D54, Q9UNU1, Q9UP85
Gene ID:
Human(9962) Summary: The absorption of vitamin C into the body and its distribution to organs requires two sodium-dependent vitamin C transporters. This gene encodes one of the two required transporters and the encoded protein accounts for tissue-specific uptake of vitamin C. Previously, this gene had an official symbol of SLC23A1. [provided by RefSeq, Jul 2008]
Mouse(54338) solute carrier family 23 (nucleobase transporters), member 2
Rat(50622) solute carrier family 23 (ascorbic acid transporter), member 2
domestic guinea pig(100714147) solute carrier family 23 (nucleobase transporters), member 2
naked mole-rat(101712807) solute carrier family 23 (nucleobase transporters), member 2
Domestic Rabbit(100009466) solute carrier family 23 (nucleobase transporters), member 2
cow(783536) solute carrier family 23 (nucleobase transporters), member 2
sheep(101113871) solute carrier family 23 (nucleobase transporters), member 2
Zebrafish(100321249) solute carrier family 23 (nucleobase transporters), member 2
chicken(419520) solute carrier family 23 (nucleobase transporters), member 2
dog(403490) solute carrier family 23 (nucleobase transporters), member 2
domestic cat(101101633) solute carrier family 23 (nucleobase transporters), member 2
Horse(100052186) solute carrier family 23 (nucleobase transporters), member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
795437 L-Ascorbic acid anhydrous, free-flowing, Redi-Dri, ACS reagent, ≥99% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005116 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005116 Rosetta Predictions human pricing
NM_203327 Rosetta Predictions human pricing
NM_017316 Rosetta Predictions rat pricing
NM_018824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339009 predicted 469
2 SASI_Hs01_00198657 predicted 2179
3 SASI_Hs01_00198658 predicted 948
4 SASI_Hs01_00198661 predicted 2372
5 SASI_Hs01_00198663 predicted 1895
6 SASI_Hs01_00198664 predicted 1218
7 SASI_Hs01_00198665 predicted 2011
8 SASI_Hs02_00339010 predicted 1921
9 SASI_Hs02_00339011 predicted 450
10 SASI_Hs02_00339012 predicted 434
11 SASI_Hs01_00198656 predicted 2263
12 SASI_Hs01_00198659 predicted 1200
13 SASI_Hs01_00198660 predicted 2382
14 SASI_Hs01_00198662 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373260 predicted 488
2 SASI_Hs01_00190907 predicted 2193
3 SASI_Hs01_00190908 predicted 965
4 SASI_Hs01_00190911 predicted 2385
5 SASI_Hs01_00190913 predicted 1920
6 SASI_Hs01_00190914 predicted 1240
7 SASI_Hs01_00190915 predicted 2028
8 SASI_Hs02_00373261 predicted 1940
9 SASI_Hs02_00373262 predicted 466
10 SASI_Hs02_00373263 predicted 453
11 SASI_Hs01_00190906 predicted 2277
12 SASI_Hs01_00190909 predicted 1219
13 SASI_Hs01_00190910 predicted 2398
14 SASI_Hs01_00190912 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080379 predicted 1422
2 SASI_Rn01_00080380 predicted 1739
3 SASI_Rn01_00080381 predicted 1051
4 SASI_Rn01_00080382 predicted 1037
5 SASI_Rn01_00080383 predicted 457
6 SASI_Rn01_00080384 predicted 2005
7 SASI_Rn01_00080385 predicted 1723
8 SASI_Rn01_00080386 predicted 1818
9 SASI_Rn01_00080387 predicted 1819
10 SASI_Rn01_00080388 predicted 1717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118895 predicted 2157
2 SASI_Mm02_00324174 predicted 724
3 SASI_Mm01_00118896 predicted 1758
4 SASI_Mm01_00118898 predicted 1793
5 SASI_Mm01_00118899 predicted 1751
6 SASI_Mm01_00118900 predicted 788
7 SASI_Mm01_00118901 predicted 813
8 SASI_Mm01_00118902 predicted 1309
9 SASI_Mm01_00118903 predicted 1150
10 SASI_Mm01_00118904 predicted 254
11 SASI_Mm01_00118897 predicted 1073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005116
VALIDATED
SLC23A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 23 (ascorbic acid transporter), member 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005116.5-1540s1c1
Sequence:CCGGGCCAGCATCATCGAGTCTATTCTCGAGAATAGACTCGATGATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005116.5-912s1c1
Sequence:CCGGCCTGTCTTTAGATAAATGGAACTCGAGTTCCATTTATCTAAAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005116.5-627s1c1
Sequence:CCGGCCAGCGATCAGACATGATTTACTCGAGTAAATCATGTCTGATCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005116.5-2163s1c1
Sequence:CCGGCGGCATGGAGTCGTACAATTTCTCGAGAAATTGTACGACTCCATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005116.5-1452s1c1
Sequence:CCGGCCCGTGGTTTAAGGTTCCATACTCGAGTATGGAACCTTAAACCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-1650s21c1
Sequence:CCGGCTGTGTTCTTGATGGCATATTCTCGAGAATATGCCATCAAGAACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-2810s21c1
Sequence:CCGGCTGACTGGCCCAGTATGATTCCTCGAGGAATCATACTGGGCCAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005116.5-1452s21c1
Sequence:CCGGCCCGTGGTTTAAGGTTCCATACTCGAGTATGGAACCTTAAACCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-1098s21c1
Sequence:CCGGCATCGGTCCCTTGACCATTACCTCGAGGTAATGGTCAAGGGACCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-2502s21c1
Sequence:CCGGTCTCGCCTATCTCCTTATTTACTCGAGTAAATAAGGAGATAGGCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-1199s21c1
Sequence:CCGGTGACAATATTCCTAGTATTACCTCGAGGTAATACTAGGAATATTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005116.5-2163s21c1
Sequence:CCGGCGGCATGGAGTCGTACAATTTCTCGAGAAATTGTACGACTCCATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005116
VALIDATED
SLC23A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 23 (ascorbic acid transporter), member 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005116.5-1540s1c1
Sequence:CCGGGCCAGCATCATCGAGTCTATTCTCGAGAATAGACTCGATGATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005116.5-912s1c1
Sequence:CCGGCCTGTCTTTAGATAAATGGAACTCGAGTTCCATTTATCTAAAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005116.5-627s1c1
Sequence:CCGGCCAGCGATCAGACATGATTTACTCGAGTAAATCATGTCTGATCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005116.5-2163s1c1
Sequence:CCGGCGGCATGGAGTCGTACAATTTCTCGAGAAATTGTACGACTCCATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005116.5-1452s1c1
Sequence:CCGGCCCGTGGTTTAAGGTTCCATACTCGAGTATGGAACCTTAAACCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-1650s21c1
Sequence:CCGGCTGTGTTCTTGATGGCATATTCTCGAGAATATGCCATCAAGAACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-2810s21c1
Sequence:CCGGCTGACTGGCCCAGTATGATTCCTCGAGGAATCATACTGGGCCAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005116.5-1452s21c1
Sequence:CCGGCCCGTGGTTTAAGGTTCCATACTCGAGTATGGAACCTTAAACCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-1098s21c1
Sequence:CCGGCATCGGTCCCTTGACCATTACCTCGAGGTAATGGTCAAGGGACCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-2502s21c1
Sequence:CCGGTCTCGCCTATCTCCTTATTTACTCGAGTAAATAAGGAGATAGGCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-1199s21c1
Sequence:CCGGTGACAATATTCCTAGTATTACCTCGAGGTAATACTAGGAATATTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005116.5-2163s21c1
Sequence:CCGGCGGCATGGAGTCGTACAATTTCTCGAGAAATTGTACGACTCCATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005116
VALIDATED
SLC23A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 23 (ascorbic acid transporter), member 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005116.5-1540s1c1
Sequence:CCGGGCCAGCATCATCGAGTCTATTCTCGAGAATAGACTCGATGATGCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005116.5-912s1c1
Sequence:CCGGCCTGTCTTTAGATAAATGGAACTCGAGTTCCATTTATCTAAAGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005116.5-627s1c1
Sequence:CCGGCCAGCGATCAGACATGATTTACTCGAGTAAATCATGTCTGATCGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005116.5-2163s1c1
Sequence:CCGGCGGCATGGAGTCGTACAATTTCTCGAGAAATTGTACGACTCCATGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005116.5-1452s1c1
Sequence:CCGGCCCGTGGTTTAAGGTTCCATACTCGAGTATGGAACCTTAAACCACGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-1650s21c1
Sequence:CCGGCTGTGTTCTTGATGGCATATTCTCGAGAATATGCCATCAAGAACACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-2810s21c1
Sequence:CCGGCTGACTGGCCCAGTATGATTCCTCGAGGAATCATACTGGGCCAGTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005116.5-1452s21c1
Sequence:CCGGCCCGTGGTTTAAGGTTCCATACTCGAGTATGGAACCTTAAACCACGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-1098s21c1
Sequence:CCGGCATCGGTCCCTTGACCATTACCTCGAGGTAATGGTCAAGGGACCGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-2502s21c1
Sequence:CCGGTCTCGCCTATCTCCTTATTTACTCGAGTAAATAAGGAGATAGGCGAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005116.5-1199s21c1
Sequence:CCGGTGACAATATTCCTAGTATTACCTCGAGGTAATACTAGGAATATTGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005116.5-2163s21c1
Sequence:CCGGCGGCATGGAGTCGTACAATTTCTCGAGAAATTGTACGACTCCATGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018824
VALIDATED
SLC23A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 23 (ascorbic acid transporter), member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018824.2-320s21c1
Sequence:CCGGGAGGCGAAGCACTCGAATTTCCTCGAGGAAATTCGAGTGCTTCGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018824.2-1120s1c1
Sequence:CCGGCCCAATTTACAAATCCAAGAACTCGAGTTCTTGGATTTGTAAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018824.2-2154s1c1
Sequence:CCGGGCCGGAGTTCAGACAAAGATTCTCGAGAATCTTTGTCTGAACTCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018824.2-1465s1c1
Sequence:CCGGGCCGCCTATCCATGCAATAAACTCGAGTTTATTGCATGGATAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018824.2-323s1c1
Sequence:CCGGGCGAAGCACTCGAATTTCTTTCTCGAGAAAGAAATTCGAGTGCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018824.2-777s1c1
Sequence:CCGGCCATCCTGTCTTTAGATAAATCTCGAGATTTATCTAAAGACAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018824.2-1513s21c1
Sequence:CCGGCTGTGTTCTTGATGGCATATTCTCGAGAATATGCCATCAAGAACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018824.2-1395s21c1
Sequence:CCGGCCGTCGTAGCCAGTATCATTGCTCGAGCAATGATACTGGCTACGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018824.2-2025s21c1
Sequence:CCGGACGGCATGGAGTCCTACAATCCTCGAGGATTGTAGGACTCCATGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018824.2-1050s21c1
Sequence:CCGGGCATTGCCATGCTGACGATTTCTCGAGAAATCGTCAGCATGGCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018824
VALIDATED
SLC23A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 23 (ascorbic acid transporter), member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018824.2-320s21c1
Sequence:CCGGGAGGCGAAGCACTCGAATTTCCTCGAGGAAATTCGAGTGCTTCGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018824.2-1120s1c1
Sequence:CCGGCCCAATTTACAAATCCAAGAACTCGAGTTCTTGGATTTGTAAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018824.2-2154s1c1
Sequence:CCGGGCCGGAGTTCAGACAAAGATTCTCGAGAATCTTTGTCTGAACTCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018824.2-1465s1c1
Sequence:CCGGGCCGCCTATCCATGCAATAAACTCGAGTTTATTGCATGGATAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018824.2-323s1c1
Sequence:CCGGGCGAAGCACTCGAATTTCTTTCTCGAGAAAGAAATTCGAGTGCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018824.2-777s1c1
Sequence:CCGGCCATCCTGTCTTTAGATAAATCTCGAGATTTATCTAAAGACAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018824.2-1513s21c1
Sequence:CCGGCTGTGTTCTTGATGGCATATTCTCGAGAATATGCCATCAAGAACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018824.2-1395s21c1
Sequence:CCGGCCGTCGTAGCCAGTATCATTGCTCGAGCAATGATACTGGCTACGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018824.2-2025s21c1
Sequence:CCGGACGGCATGGAGTCCTACAATCCTCGAGGATTGTAGGACTCCATGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018824.2-1050s21c1
Sequence:CCGGGCATTGCCATGCTGACGATTTCTCGAGAAATCGTCAGCATGGCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018824
VALIDATED
SLC23A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 23 (ascorbic acid transporter), member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018824.2-320s21c1
Sequence:CCGGGAGGCGAAGCACTCGAATTTCCTCGAGGAAATTCGAGTGCTTCGCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018824.2-1120s1c1
Sequence:CCGGCCCAATTTACAAATCCAAGAACTCGAGTTCTTGGATTTGTAAATTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018824.2-2154s1c1
Sequence:CCGGGCCGGAGTTCAGACAAAGATTCTCGAGAATCTTTGTCTGAACTCCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018824.2-1465s1c1
Sequence:CCGGGCCGCCTATCCATGCAATAAACTCGAGTTTATTGCATGGATAGGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018824.2-323s1c1
Sequence:CCGGGCGAAGCACTCGAATTTCTTTCTCGAGAAAGAAATTCGAGTGCTTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018824.2-777s1c1
Sequence:CCGGCCATCCTGTCTTTAGATAAATCTCGAGATTTATCTAAAGACAGGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018824.2-1513s21c1
Sequence:CCGGCTGTGTTCTTGATGGCATATTCTCGAGAATATGCCATCAAGAACACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018824.2-1395s21c1
Sequence:CCGGCCGTCGTAGCCAGTATCATTGCTCGAGCAATGATACTGGCTACGACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018824.2-2025s21c1
Sequence:CCGGACGGCATGGAGTCCTACAATCCTCGAGGATTGTAGGACTCCATGCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018824.2-1050s21c1
Sequence:CCGGGCATTGCCATGCTGACGATTTCTCGAGAAATCGTCAGCATGGCAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)