EMAIL THIS PAGE TO A FRIEND

SLC25A21

solute carrier family 25 (mitochondrial oxoadipate carrier), member 21

70 Gene Product Result for
Synonyms: ODC ODC1
UniProtKB ID: Q9BQT8, A8K0L0, G3V4L5, Q3MJ99
Gene ID:
Human(89874) Summary: SLC25A21 is a homolog of the S. cerevisiae ODC proteins, mitochondrial carriers that transport C5-C7 oxodicarboxylates across inner mitochondrial membranes. One of the species transported by ODC is 2-oxoadipate, a common intermediate in the catabolism of lysine, tryptophan, and hydroxylysine in mammals. Within mitochondria, 2-oxoadipate is converted into acetyl-CoA.[supplied by OMIM, Apr 2004]
Mouse(217593) solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21
Rat(171151) solute carrier family 25 (mitochondrial oxoadipate carrier), member 21
Zebrafish(767694) solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21
domestic cat(101092523) solute carrier family 25 (mitochondrial oxoadipate carrier), member 21
dog(490655) solute carrier family 25 (mitochondrial oxoadipate carrier), member 21
chicken(423330) solute carrier family 25 (mitochondrial oxoadipate carrier), member 21
cow(513423) solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21
sheep(101121458) solute carrier family 25 (mitochondrial oxoadipate carrier), member 21
domestic guinea pig(100730196) solute carrier family 25 (mitochondrial oxoadipate carrier), member 21
naked mole-rat(101703825) solute carrier family 25 (mitochondrial oxoadipate carrier), member 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030631 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030631 Rosetta Predictions human pricing
NM_133614 Rosetta Predictions rat pricing
NM_172577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093745 predicted 1173
2 SASI_Hs01_00093746 predicted 871
3 SASI_Hs02_00358195 predicted 1270
4 SASI_Hs01_00093748 predicted 1206
5 SASI_Hs01_00093749 predicted 1189
6 SASI_Hs01_00093750 predicted 962
7 SASI_Hs02_00358196 predicted 677
8 SASI_Hs02_00358197 predicted 969
9 SASI_Hs01_00093753 predicted 1273
10 SASI_Hs01_00093754 predicted 895
11 SASI_Hs01_00093747 predicted 585
12 SASI_Hs01_00093751 predicted 591
13 SASI_Hs01_00093752 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133614 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037698 predicted 834
2 SASI_Rn01_00037699 predicted 804
3 SASI_Rn01_00037700 predicted 383
4 SASI_Rn01_00037701 predicted 1208
5 SASI_Rn01_00037702 predicted 593
6 SASI_Rn01_00037703 predicted 654
7 SASI_Rn01_00037704 predicted 541
8 SASI_Rn01_00037705 predicted 810
9 SASI_Rn01_00037706 predicted 465
10 SASI_Rn01_00037707 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196509 predicted 872
2 SASI_Mm01_00196510 predicted 1397
3 SASI_Mm01_00196511 predicted 1092
4 SASI_Mm01_00196512 predicted 661
5 SASI_Mm01_00196513 predicted 814
6 SASI_Mm01_00196514 predicted 845
7 SASI_Mm01_00196515 predicted 1176
8 SASI_Mm01_00196516 predicted 942
9 SASI_Mm01_00196517 predicted 1427
10 SASI_Mm01_00196518 predicted 1378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030631
SLC25A21 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial oxoadipate carrier), member 21
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-1103s1c1
Sequence:CCGGGCTTTGTACAAAGGCCTGCTTCTCGAGAAGCAGGCCTTTGTACAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-721s1c1
Sequence:CCGGGCAAGCAAATCGGAACACATTCTCGAGAATGTGTTCCGATTTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-598s1c1
Sequence:CCGGGTACAAGAAATTGCTGGGATACTCGAGTATCCCAGCAATTTCTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-972s1c1
Sequence:CCGGCCTCAGTCATTAACATCCCTTCTCGAGAAGGGATGTTAATGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-817s1c1
Sequence:CCGGCAAAGGATTAACTGCAACTTTCTCGAGAAAGTTGCAGTTAATCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030631
SLC25A21 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial oxoadipate carrier), member 21
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-1103s1c1
Sequence:CCGGGCTTTGTACAAAGGCCTGCTTCTCGAGAAGCAGGCCTTTGTACAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-721s1c1
Sequence:CCGGGCAAGCAAATCGGAACACATTCTCGAGAATGTGTTCCGATTTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-598s1c1
Sequence:CCGGGTACAAGAAATTGCTGGGATACTCGAGTATCCCAGCAATTTCTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-972s1c1
Sequence:CCGGCCTCAGTCATTAACATCCCTTCTCGAGAAGGGATGTTAATGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-817s1c1
Sequence:CCGGCAAAGGATTAACTGCAACTTTCTCGAGAAAGTTGCAGTTAATCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030631
SLC25A21 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial oxoadipate carrier), member 21
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-1103s1c1
Sequence:CCGGGCTTTGTACAAAGGCCTGCTTCTCGAGAAGCAGGCCTTTGTACAAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-721s1c1
Sequence:CCGGGCAAGCAAATCGGAACACATTCTCGAGAATGTGTTCCGATTTGCTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-598s1c1
Sequence:CCGGGTACAAGAAATTGCTGGGATACTCGAGTATCCCAGCAATTTCTTGTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-972s1c1
Sequence:CCGGCCTCAGTCATTAACATCCCTTCTCGAGAAGGGATGTTAATGACTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030631.1-817s1c1
Sequence:CCGGCAAAGGATTAACTGCAACTTTCTCGAGAAAGTTGCAGTTAATCCTTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172577
SLC25A21 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial oxoadipate carrier), member 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-1387s1c1
Sequence:CCGGCTGGTGTATGAATACACCTATCTCGAGATAGGTGTATTCATACACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-665s1c1
Sequence:CCGGGAAGTGTAACAGACCCACAAACTCGAGTTTGTGGGTCTGTTACACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-750s1c1
Sequence:CCGGCAAGGGAATTATCCCACCAATCTCGAGATTGGTGGGATAATTCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-1294s1c1
Sequence:CCGGGAGATGATCTACCGGGAAGAACTCGAGTTCTTCCCGGTAGATCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-952s1c1
Sequence:CCGGCGGAACTTGTTCAAAGAGCAACTCGAGTTGCTCTTTGAACAAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172577
SLC25A21 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial oxoadipate carrier), member 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-1387s1c1
Sequence:CCGGCTGGTGTATGAATACACCTATCTCGAGATAGGTGTATTCATACACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-665s1c1
Sequence:CCGGGAAGTGTAACAGACCCACAAACTCGAGTTTGTGGGTCTGTTACACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-750s1c1
Sequence:CCGGCAAGGGAATTATCCCACCAATCTCGAGATTGGTGGGATAATTCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-1294s1c1
Sequence:CCGGGAGATGATCTACCGGGAAGAACTCGAGTTCTTCCCGGTAGATCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-952s1c1
Sequence:CCGGCGGAACTTGTTCAAAGAGCAACTCGAGTTGCTCTTTGAACAAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172577
SLC25A21 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial oxoadipate carrier), member 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-1387s1c1
Sequence:CCGGCTGGTGTATGAATACACCTATCTCGAGATAGGTGTATTCATACACCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-665s1c1
Sequence:CCGGGAAGTGTAACAGACCCACAAACTCGAGTTTGTGGGTCTGTTACACTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-750s1c1
Sequence:CCGGCAAGGGAATTATCCCACCAATCTCGAGATTGGTGGGATAATTCCCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-1294s1c1
Sequence:CCGGGAGATGATCTACCGGGAAGAACTCGAGTTCTTCCCGGTAGATCATCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000068390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172577.1-952s1c1
Sequence:CCGGCGGAACTTGTTCAAAGAGCAACTCGAGTTGCTCTTTGAACAAGTTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???