EMAIL THIS PAGE TO A FRIEND

SLC25A26

solute carrier family 25 (S-adenosylmethionine carrier), member 26

134 Gene Product Result for
Synonyms: SAMC
UniProtKB ID: Q70HW3, A8K758, B3KRZ7, Q7Z786, Q96E68
Gene ID:
Human(115286) Summary: Mitochondrial carriers, including SLC25A26, are a family of transport proteins found mostly in the inner membranes of mitochondria. They shuttle metabolites and cofactors through the mitochondrial membrane (Agrimi et al., 2004 [PubMed 14674884]
Mouse(67582) solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 26
Rat(362403) solute carrier family 25 (S-adenosylmethionine carrier), member 26
Zebrafish(560478) solute carrier family 25, member 26
chicken(416084) solute carrier family 25 (S-adenosylmethionine carrier), member 26
dog(611050) solute carrier family 25 (S-adenosylmethionine carrier), member 26
domestic cat(101087648) solute carrier family 25 (S-adenosylmethionine carrier), member 26
naked mole-rat(101711931) solute carrier family 25 (S-adenosylmethionine carrier), member 26
domestic guinea pig(100719522) solute carrier family 25 (S-adenosylmethionine carrier), member 26
cow(614713) solute carrier family 25 (S-adenosylmethionine carrier), member 26
sheep(100147801) solute carrier family 25 (S-adenosylmethionine carrier), member 26
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA026887 Anti-SLC25A26 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173471 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009937 Rosetta Predictions human pricing
NM_001009938 Rosetta Predictions human pricing
NM_173471 Rosetta Predictions human pricing
NM_001108638 Rosetta Predictions rat pricing
NM_026255 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112074 predicted 863
2 SASI_Hs01_00112075 predicted 797
3 SASI_Hs01_00112076 predicted 864
4 SASI_Hs01_00112077 predicted 782
5 SASI_Hs01_00112078 predicted 818
6 SASI_Hs01_00112079 predicted 870
7 SASI_Hs01_00112080 predicted 872
8 SASI_Hs01_00112081 predicted 783
9 SASI_Hs01_00112082 predicted 790
10 SASI_Hs01_00112083 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027496 predicted 756
2 SASI_Hs01_00027497 predicted 707
3 SASI_Hs01_00027498 predicted 759
4 SASI_Hs01_00027499 predicted 685
5 SASI_Hs01_00027500 predicted 711
6 SASI_Hs01_00027501 predicted 766
7 SASI_Hs01_00027502 predicted 766
8 SASI_Hs01_00027503 predicted 683
9 SASI_Hs01_00027504 predicted 696
10 SASI_Hs01_00027505 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368216 predicted 1086
2 SASI_Hs02_00368217 predicted 497
3 SASI_Hs02_00368218 predicted 423
4 SASI_Hs02_00368219 predicted 459
5 SASI_Hs02_00368220 predicted 1093
6 SASI_Hs02_00368221 predicted 1102
7 SASI_Hs02_00368222 predicted 437
8 SASI_Hs02_00368223 predicted 585
9 SASI_Hs02_00368224 predicted 725
10 SASI_Hs02_00368225 predicted 1110
11 SASI_Hs01_00038256 predicted 703
12 SASI_Hs01_00038257 predicted 645
13 SASI_Hs01_00038258 predicted 699
14 SASI_Hs01_00038259 predicted 621
15 SASI_Hs01_00038260 predicted 649
16 SASI_Hs01_00038261 predicted 708
17 SASI_Hs01_00038262 predicted 709
18 SASI_Hs01_00038263 predicted 616
19 SASI_Hs01_00038264 predicted 628
20 SASI_Hs01_00038265 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240599 predicted 811
2 SASI_Rn02_00240600 predicted 284
3 SASI_Rn02_00240601 predicted 430
4 SASI_Rn02_00240602 predicted 838
5 SASI_Rn02_00240603 predicted 380
6 SASI_Rn02_00240604 predicted 381
7 SASI_Rn02_00240605 predicted 772
8 SASI_Rn02_00240606 predicted 504
9 SASI_Rn02_00240607 predicted 622
10 SASI_Rn02_00240608 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187542 predicted 387
2 SASI_Mm01_00187543 predicted 483
3 SASI_Mm01_00187544 predicted 278
4 SASI_Mm01_00187545 predicted 898
5 SASI_Mm01_00187546 predicted 309
6 SASI_Mm01_00187547 predicted 396
7 SASI_Mm01_00187548 predicted 894
8 SASI_Mm01_00187549 predicted 647
9 SASI_Mm01_00187551 predicted 689
10 SASI_Mm02_00329940 predicted 808
11 SASI_Mm01_00187550 predicted 476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173471
VALIDATED
SLC25A26 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (S-adenosylmethionine carrier), member 26
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-870s21c1
Sequence:CCGGGGAATATATGCTGGCGTTCCTCTCGAGAGGAACGCCAGCATATATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173471.1-527s1c1
Sequence:CCGGGACAAGAATTACGCTGGCAAACTCGAGTTTGCCAGCGTAATTCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-1468s21c1
Sequence:CCGGCCATCAGTCTGGGAGGTTTCACTCGAGTGAAACCTCCCAGACTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-1247s21c1
Sequence:CCGGGGATCATGTGGTGGATTCTTGCTCGAGCAAGAATCCACCACATGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-966s21c1
Sequence:CCGGGCTGATTCATCTTCATATTTGCTCGAGCAAATATGAAGATGAATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-801s21c1
Sequence:CCGGTTTCCTCTGGATACCATTAAACTCGAGTTTAATGGTATCCAGAGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-1271s21c1
Sequence:CCGGGTCAGCAGTCTGTGGAGCTTTCTCGAGAAAGCTCCACAGACTGCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173471
VALIDATED
SLC25A26 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (S-adenosylmethionine carrier), member 26
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-870s21c1
Sequence:CCGGGGAATATATGCTGGCGTTCCTCTCGAGAGGAACGCCAGCATATATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173471.1-527s1c1
Sequence:CCGGGACAAGAATTACGCTGGCAAACTCGAGTTTGCCAGCGTAATTCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-1468s21c1
Sequence:CCGGCCATCAGTCTGGGAGGTTTCACTCGAGTGAAACCTCCCAGACTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-1247s21c1
Sequence:CCGGGGATCATGTGGTGGATTCTTGCTCGAGCAAGAATCCACCACATGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-966s21c1
Sequence:CCGGGCTGATTCATCTTCATATTTGCTCGAGCAAATATGAAGATGAATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-801s21c1
Sequence:CCGGTTTCCTCTGGATACCATTAAACTCGAGTTTAATGGTATCCAGAGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-1271s21c1
Sequence:CCGGGTCAGCAGTCTGTGGAGCTTTCTCGAGAAAGCTCCACAGACTGCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173471
VALIDATED
SLC25A26 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (S-adenosylmethionine carrier), member 26
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-870s21c1
Sequence:CCGGGGAATATATGCTGGCGTTCCTCTCGAGAGGAACGCCAGCATATATTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000044153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_173471.1-527s1c1
Sequence:CCGGGACAAGAATTACGCTGGCAAACTCGAGTTTGCCAGCGTAATTCTTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-1468s21c1
Sequence:CCGGCCATCAGTCTGGGAGGTTTCACTCGAGTGAAACCTCCCAGACTGATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000421363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-1247s21c1
Sequence:CCGGGGATCATGTGGTGGATTCTTGCTCGAGCAAGAATCCACCACATGATCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000412986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-966s21c1
Sequence:CCGGGCTGATTCATCTTCATATTTGCTCGAGCAAATATGAAGATGAATCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000419332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-801s21c1
Sequence:CCGGTTTCCTCTGGATACCATTAAACTCGAGTTTAATGGTATCCAGAGGAAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173471.3-1271s21c1
Sequence:CCGGGTCAGCAGTCTGTGGAGCTTTCTCGAGAAAGCTCCACAGACTGCTGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026255
VALIDATED
SLC25A26 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (S-adenosylmethionine carrier), member 26
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026255.2-217s1c1
Sequence:CCGGTGGTGGATTTCGTGGGATATACTCGAGTATATCCCACGAAATCCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026255.2-691s1c1
Sequence:CCGGCGTGGCTAAGACAAGGATCATCTCGAGATGATCCTTGTCTTAGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026255.2-142s1c1
Sequence:CCGGCTCTGTGGACTTGATATTATTCTCGAGAATAATATCAAGTCCACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026255.2-325s1c1
Sequence:CCGGCACGGACTCTACTTCACACTTCTCGAGAAGTGTGAAGTAGAGTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026255.2-562s1c1
Sequence:CCGGGTTTCCCTTGTGGGAATCCTTCTCGAGAAGGATTCCCACAAGGGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026255.4-492s21c1
Sequence:CCGGGGACTGTACCGAGGCTATAAACTCGAGTTTATAGCCTCGGTACAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026255.4-1044s21c1
Sequence:CCGGCGTCTCAGTCCTCTCAATAAACTCGAGTTTATTGAGAGGACTGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026255.4-314s21c1
Sequence:CCGGCACGGACTCTACTTCACACTTCTCGAGAAGTGTGAAGTAGAGTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026255.4-770s21c1
Sequence:CCGGACAGGGACTAGCCGGGTTATTCTCGAGAATAACCCGGCTAGTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026255.4-1242s21c1
Sequence:CCGGTGCCTATTGTGTAAGATTATACTCGAGTATAATCTTACACAATAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026255
VALIDATED
SLC25A26 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (S-adenosylmethionine carrier), member 26
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026255.2-217s1c1
Sequence:CCGGTGGTGGATTTCGTGGGATATACTCGAGTATATCCCACGAAATCCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026255.2-691s1c1
Sequence:CCGGCGTGGCTAAGACAAGGATCATCTCGAGATGATCCTTGTCTTAGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026255.2-142s1c1
Sequence:CCGGCTCTGTGGACTTGATATTATTCTCGAGAATAATATCAAGTCCACAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026255.2-325s1c1
Sequence:CCGGCACGGACTCTACTTCACACTTCTCGAGAAGTGTGAAGTAGAGTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026255.2-562s1c1
Sequence:CCGGGTTTCCCTTGTGGGAATCCTTCTCGAGAAGGATTCCCACAAGGGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026255.4-492s21c1
Sequence:CCGGGGACTGTACCGAGGCTATAAACTCGAGTTTATAGCCTCGGTACAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026255.4-1044s21c1
Sequence:CCGGCGTCTCAGTCCTCTCAATAAACTCGAGTTTATTGAGAGGACTGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026255.4-314s21c1
Sequence:CCGGCACGGACTCTACTTCACACTTCTCGAGAAGTGTGAAGTAGAGTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026255.4-770s21c1
Sequence:CCGGACAGGGACTAGCCGGGTTATTCTCGAGAATAACCCGGCTAGTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026255.4-1242s21c1
Sequence:CCGGTGCCTATTGTGTAAGATTATACTCGAGTATAATCTTACACAATAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026255
VALIDATED
SLC25A26 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (S-adenosylmethionine carrier), member 26
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026255.2-217s1c1
Sequence:CCGGTGGTGGATTTCGTGGGATATACTCGAGTATATCCCACGAAATCCACCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026255.2-691s1c1
Sequence:CCGGCGTGGCTAAGACAAGGATCATCTCGAGATGATCCTTGTCTTAGCCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026255.2-142s1c1
Sequence:CCGGCTCTGTGGACTTGATATTATTCTCGAGAATAATATCAAGTCCACAGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026255.2-325s1c1
Sequence:CCGGCACGGACTCTACTTCACACTTCTCGAGAAGTGTGAAGTAGAGTCCGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026255.2-562s1c1
Sequence:CCGGGTTTCCCTTGTGGGAATCCTTCTCGAGAAGGATTCCCACAAGGGAAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000349941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026255.4-492s21c1
Sequence:CCGGGGACTGTACCGAGGCTATAAACTCGAGTTTATAGCCTCGGTACAGTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000375327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026255.4-1044s21c1
Sequence:CCGGCGTCTCAGTCCTCTCAATAAACTCGAGTTTATTGAGAGGACTGAGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000317479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026255.4-314s21c1
Sequence:CCGGCACGGACTCTACTTCACACTTCTCGAGAAGTGTGAAGTAGAGTCCGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026255.4-770s21c1
Sequence:CCGGACAGGGACTAGCCGGGTTATTCTCGAGAATAACCCGGCTAGTCCCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026255.4-1242s21c1
Sequence:CCGGTGCCTATTGTGTAAGATTATACTCGAGTATAATCTTACACAATAGGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???