EMAIL THIS PAGE TO A FRIEND

SLC25A28

solute carrier family 25 (mitochondrial iron transporter), member 28

61 Gene Product Result for
Synonyms: MFRN2 MRS3/4 MRS4L
UniProtKB ID: Q96A46, Q4VBZ0, Q5T777, Q86VX5, Q969G8, Q9H2J3
Gene ID:
Mouse(246696) solute carrier family 25, member 28
Rat(688811) solute carrier family 25 (mitochondrial iron transporter), member 28
Zebrafish(406393) solute carrier family 25, member 28
chicken(423832) solute carrier family 25, member 28
dog(486837) solute carrier family 25 (mitochondrial iron transporter), member 28
naked mole-rat(101714681) solute carrier family 25 (mitochondrial iron transporter), member 28
domestic guinea pig(100717996) solute carrier family 25 (mitochondrial iron transporter), member 28
cow(538529) solute carrier family 25, member 28
sheep(101110892) solute carrier family 25 (mitochondrial iron transporter), member 28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031212 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031212 Rosetta Predictions human pricing
NM_001109515 Rosetta Predictions rat pricing
NM_145156 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166546 predicted 843
2 SASI_Hs01_00166548 predicted 1294
3 SASI_Hs01_00166549 predicted 1062
4 SASI_Hs02_00358616 predicted 600
5 SASI_Hs02_00358617 predicted 627
6 SASI_Hs01_00166550 predicted 1051
7 SASI_Hs01_00166552 predicted 1053
8 SASI_Hs01_00166553 predicted 1157
9 SASI_Hs01_00166555 predicted 750
10 SASI_Hs02_00358618 predicted 479
11 SASI_Hs01_00166547 predicted 1233
12 SASI_Hs01_00166551 predicted 1512
13 SASI_Hs01_00166554 predicted 1560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249159 predicted 744
2 SASI_Rn02_00249160 predicted 734
3 SASI_Rn02_00249161 predicted 846
4 SASI_Rn02_00249162 predicted 585
5 SASI_Rn02_00249163 predicted 1131
6 SASI_Rn02_00249164 predicted 1199
7 SASI_Rn02_00249165 predicted 730
8 SASI_Rn02_00249166 predicted 1280
9 SASI_Rn02_00249167 predicted 1152
10 SASI_Rn02_00249168 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024682 predicted 610
2 SASI_Mm01_00024683 predicted 646
3 SASI_Mm01_00024684 predicted 1289
4 SASI_Mm01_00024685 predicted 585
5 SASI_Mm01_00024686 predicted 1018
6 SASI_Mm01_00024688 predicted 824
7 SASI_Mm01_00024689 predicted 737
8 SASI_Mm01_00024690 predicted 740
9 SASI_Mm01_00024691 predicted 633
10 SASI_Mm02_00340584 predicted 1125
11 SASI_Mm01_00024687 predicted 725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031212
SLC25A28 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial iron transporter), member 28
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031212.3-1160s21c1
Sequence:CCGGCTGTGTATGAGTTCTTCAAATCTCGAGATTTGAAGAACTCATACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031212.3-476s21c1
Sequence:CCGGAGGCCCTCTGGAGGATTATAACTCGAGTTATAATCCTCCAGAGGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1352s1c1
Sequence:CCGGCTTGGCTTTGAACTCACACATCTCGAGATGTGTGAGTTCAAAGCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1064s1c1
Sequence:CCGGGCAGATGTACAACTCACCATACTCGAGTATGGTGAGTTGTACATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1493s1c1
Sequence:CCGGCGCATGGTCTGTGTATGAGTTCTCGAGAACTCATACACAGACCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1364s1c1
Sequence:CCGGCTCACACATTACAGGACATATCTCGAGATATGTCCTGTAATGTGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1163s1c1
Sequence:CCGGGCTGACCATGAACGTTCCTTTCTCGAGAAAGGAACGTTCATGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031212.3-1110s21c1
Sequence:CCGGGGTGCAGGCCAGAGTAATTTACTCGAGTAAATTACTCTGGCCTGCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031212.3-1261s21c1
Sequence:CCGGTGCTGCATCCTGGTCACATTCCTCGAGGAATGTGACCAGGATGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031212.3-1057s21c1
Sequence:CCGGAGTGCCTTCAGGACGGTATATCTCGAGATATACCGTCCTGAAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031212
SLC25A28 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial iron transporter), member 28
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031212.3-1160s21c1
Sequence:CCGGCTGTGTATGAGTTCTTCAAATCTCGAGATTTGAAGAACTCATACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031212.3-476s21c1
Sequence:CCGGAGGCCCTCTGGAGGATTATAACTCGAGTTATAATCCTCCAGAGGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1352s1c1
Sequence:CCGGCTTGGCTTTGAACTCACACATCTCGAGATGTGTGAGTTCAAAGCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1064s1c1
Sequence:CCGGGCAGATGTACAACTCACCATACTCGAGTATGGTGAGTTGTACATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1493s1c1
Sequence:CCGGCGCATGGTCTGTGTATGAGTTCTCGAGAACTCATACACAGACCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1364s1c1
Sequence:CCGGCTCACACATTACAGGACATATCTCGAGATATGTCCTGTAATGTGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1163s1c1
Sequence:CCGGGCTGACCATGAACGTTCCTTTCTCGAGAAAGGAACGTTCATGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031212.3-1110s21c1
Sequence:CCGGGGTGCAGGCCAGAGTAATTTACTCGAGTAAATTACTCTGGCCTGCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031212.3-1261s21c1
Sequence:CCGGTGCTGCATCCTGGTCACATTCCTCGAGGAATGTGACCAGGATGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031212.3-1057s21c1
Sequence:CCGGAGTGCCTTCAGGACGGTATATCTCGAGATATACCGTCCTGAAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031212
SLC25A28 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial iron transporter), member 28
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031212.3-1160s21c1
Sequence:CCGGCTGTGTATGAGTTCTTCAAATCTCGAGATTTGAAGAACTCATACACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031212.3-476s21c1
Sequence:CCGGAGGCCCTCTGGAGGATTATAACTCGAGTTATAATCCTCCAGAGGGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1352s1c1
Sequence:CCGGCTTGGCTTTGAACTCACACATCTCGAGATGTGTGAGTTCAAAGCCAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1064s1c1
Sequence:CCGGGCAGATGTACAACTCACCATACTCGAGTATGGTGAGTTGTACATCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1493s1c1
Sequence:CCGGCGCATGGTCTGTGTATGAGTTCTCGAGAACTCATACACAGACCATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1364s1c1
Sequence:CCGGCTCACACATTACAGGACATATCTCGAGATATGTCCTGTAATGTGTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031212.2-1163s1c1
Sequence:CCGGGCTGACCATGAACGTTCCTTTCTCGAGAAAGGAACGTTCATGGTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031212.3-1110s21c1
Sequence:CCGGGGTGCAGGCCAGAGTAATTTACTCGAGTAAATTACTCTGGCCTGCACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031212.3-1261s21c1
Sequence:CCGGTGCTGCATCCTGGTCACATTCCTCGAGGAATGTGACCAGGATGCAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031212.3-1057s21c1
Sequence:CCGGAGTGCCTTCAGGACGGTATATCTCGAGATATACCGTCCTGAAGGCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145156
SLC25A28 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial iron transporter), member 28
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-367s1c1
Sequence:CCGGCCTGGAGCATTGCGTGATGTACTCGAGTACATCACGCAATGCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-1139s1c1
Sequence:CCGGGCATGGTCTGTGTATGAATTTCTCGAGAAATTCATACACAGACCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-641s1c1
Sequence:CCGGGCCGGATGTGTGGCGACATTACTCGAGTAATGTCGCCACACATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-700s1c1
Sequence:CCGGGCAGAGGATGCAGATGTACAACTCGAGTTGTACATCTGCATCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-855s1c1
Sequence:CCGGAGTTCCTGCAAGAGCACTTTACTCGAGTAAAGTGCTCTTGCAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145156
SLC25A28 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial iron transporter), member 28
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-367s1c1
Sequence:CCGGCCTGGAGCATTGCGTGATGTACTCGAGTACATCACGCAATGCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-1139s1c1
Sequence:CCGGGCATGGTCTGTGTATGAATTTCTCGAGAAATTCATACACAGACCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-641s1c1
Sequence:CCGGGCCGGATGTGTGGCGACATTACTCGAGTAATGTCGCCACACATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-700s1c1
Sequence:CCGGGCAGAGGATGCAGATGTACAACTCGAGTTGTACATCTGCATCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-855s1c1
Sequence:CCGGAGTTCCTGCAAGAGCACTTTACTCGAGTAAAGTGCTCTTGCAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145156
SLC25A28 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial iron transporter), member 28
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-367s1c1
Sequence:CCGGCCTGGAGCATTGCGTGATGTACTCGAGTACATCACGCAATGCTCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-1139s1c1
Sequence:CCGGGCATGGTCTGTGTATGAATTTCTCGAGAAATTCATACACAGACCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-641s1c1
Sequence:CCGGGCCGGATGTGTGGCGACATTACTCGAGTAATGTCGCCACACATCCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-700s1c1
Sequence:CCGGGCAGAGGATGCAGATGTACAACTCGAGTTGTACATCTGCATCCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145156.1-855s1c1
Sequence:CCGGAGTTCCTGCAAGAGCACTTTACTCGAGTAAAGTGCTCTTGCAGGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)