EMAIL THIS PAGE TO A FRIEND

SLC25A30

solute carrier family 25, member 30

64 Gene Product Result for
Synonyms: KMCP1
UniProtKB ID: Q5SVS4, B2RN96
Gene ID:
Human(253512) Summary: Although the outer mitochondrial membrane is permeable to many small metabolites, transport of solutes across the inner mitochondrial membrane is achieved by members of the mitochondrial carrier protein family, such as SLC25A30 (Haguenauer et al., 2005 [PubMed 15809292]
Mouse(67554) solute carrier family 25, member 30
Rat(361074) solute carrier family 25, member 30
cow(507021) solute carrier family 25, member 30
domestic guinea pig(100716493) solute carrier family 25, member 30
naked mole-rat(101714472) solute carrier family 25, member 30
chicken(418845) solute carrier family 25, member 30
dog(609084) solute carrier family 25, member 30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010875 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026232 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026232 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026232 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088981 MISSION® esiRNA esiRNA human SLC25A30 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010875 Rosetta Predictions human pricing
NM_001013187 Rosetta Predictions rat pricing
NM_026232 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305831 predicted 465
2 SASI_Hs01_00144067 predicted 235
3 SASI_Hs01_00144068 predicted 295
4 SASI_Hs01_00144069 predicted 785
5 SASI_Hs01_00144070 predicted 553
6 SASI_Hs01_00144072 predicted 199
7 SASI_Hs01_00144073 predicted 497
8 SASI_Hs01_00144074 predicted 283
9 SASI_Hs02_00305832 predicted 558
10 SASI_Hs01_00144076 predicted 433
11 SASI_Hs01_00144071 predicted 312
12 SASI_Hs01_00144075 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096109 predicted 1020
2 SASI_Rn01_00096110 predicted 358
3 SASI_Rn01_00096111 predicted 849
4 SASI_Rn01_00096112 predicted 989
5 SASI_Rn01_00096113 predicted 1006
6 SASI_Rn01_00096114 predicted 370
7 SASI_Rn01_00096116 predicted 815
8 SASI_Rn01_00096117 predicted 478
9 SASI_Rn01_00096118 predicted 773
10 SASI_Rn02_00200948 predicted 868
11 SASI_Rn01_00096115 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131879 predicted 513
2 SASI_Mm01_00131880 predicted 824
3 SASI_Mm02_00329910 predicted 923
4 SASI_Mm01_00131881 predicted 846
5 SASI_Mm01_00131882 predicted 897
6 SASI_Mm02_00329911 predicted 1113
7 SASI_Mm01_00131885 predicted 425
8 SASI_Mm01_00131886 predicted 530
9 SASI_Mm01_00131888 predicted 741
10 SASI_Mm02_00329912 predicted 498
11 SASI_Mm01_00131883 predicted 627
12 SASI_Mm01_00131884 predicted 280
13 SASI_Mm01_00131887 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010875
SLC25A30 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25, member 30
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010875.2-379s21c1
Sequence:CCGGCCTATGGCACCATCAAGATAGCTCGAGCTATCTTGATGGTGCCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010875.1-409s1c1
Sequence:CCGGGAGCTTGAAGCGACTATTCATCTCGAGATGAATAGTCGCTTCAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010875.1-549s1c1
Sequence:CCGGGCAACACCATTCAAGGAGGAACTCGAGTTCCTCCTTGAATGGTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010875.1-236s1c1
Sequence:CCGGCAGATTCAAGGCCAGACGAATCTCGAGATTCGTCTGGCCTTGAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010875.1-539s1c1
Sequence:CCGGCAAGCGCAAAGCAACACCATTCTCGAGAATGGTGTTGCTTTGCGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010875.2-1180s21c1
Sequence:CCGGGCTCTTCATCAAACGTTTAATCTCGAGATTAAACGTTTGATGAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010875.2-1140s21c1
Sequence:CCGGAGACTGGGTTAGTTGAGATTGCTCGAGCAATCTCAACTAACCCAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010875.2-868s21c1
Sequence:CCGGGAACCCTGGATTGCTTGTTACCTCGAGGTAACAAGCAATCCAGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010875.2-492s21c1
Sequence:CCGGATATCTTCAACCATTGCTAATCTCGAGATTAGCAATGGTTGAAGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010875
SLC25A30 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25, member 30
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010875.2-379s21c1
Sequence:CCGGCCTATGGCACCATCAAGATAGCTCGAGCTATCTTGATGGTGCCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010875.1-409s1c1
Sequence:CCGGGAGCTTGAAGCGACTATTCATCTCGAGATGAATAGTCGCTTCAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010875.1-549s1c1
Sequence:CCGGGCAACACCATTCAAGGAGGAACTCGAGTTCCTCCTTGAATGGTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010875.1-236s1c1
Sequence:CCGGCAGATTCAAGGCCAGACGAATCTCGAGATTCGTCTGGCCTTGAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010875.1-539s1c1
Sequence:CCGGCAAGCGCAAAGCAACACCATTCTCGAGAATGGTGTTGCTTTGCGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010875.2-1180s21c1
Sequence:CCGGGCTCTTCATCAAACGTTTAATCTCGAGATTAAACGTTTGATGAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010875.2-1140s21c1
Sequence:CCGGAGACTGGGTTAGTTGAGATTGCTCGAGCAATCTCAACTAACCCAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010875.2-868s21c1
Sequence:CCGGGAACCCTGGATTGCTTGTTACCTCGAGGTAACAAGCAATCCAGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010875.2-492s21c1
Sequence:CCGGATATCTTCAACCATTGCTAATCTCGAGATTAGCAATGGTTGAAGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010875
SLC25A30 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25, member 30
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010875.2-379s21c1
Sequence:CCGGCCTATGGCACCATCAAGATAGCTCGAGCTATCTTGATGGTGCCATAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010875.1-409s1c1
Sequence:CCGGGAGCTTGAAGCGACTATTCATCTCGAGATGAATAGTCGCTTCAAGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010875.1-549s1c1
Sequence:CCGGGCAACACCATTCAAGGAGGAACTCGAGTTCCTCCTTGAATGGTGTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010875.1-236s1c1
Sequence:CCGGCAGATTCAAGGCCAGACGAATCTCGAGATTCGTCTGGCCTTGAATCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010875.1-539s1c1
Sequence:CCGGCAAGCGCAAAGCAACACCATTCTCGAGAATGGTGTTGCTTTGCGCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010875.2-1180s21c1
Sequence:CCGGGCTCTTCATCAAACGTTTAATCTCGAGATTAAACGTTTGATGAAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010875.2-1140s21c1
Sequence:CCGGAGACTGGGTTAGTTGAGATTGCTCGAGCAATCTCAACTAACCCAGTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010875.2-868s21c1
Sequence:CCGGGAACCCTGGATTGCTTGTTACCTCGAGGTAACAAGCAATCCAGGGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010875.2-492s21c1
Sequence:CCGGATATCTTCAACCATTGCTAATCTCGAGATTAGCAATGGTTGAAGATATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026232
SLC25A30 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25, member 30
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026232.3-1286s21c1
Sequence:CCGGCTAGATAACTGATGTACATAACTCGAGTTATGTACATCAGTTATCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026232.3-243s21c1
Sequence:CCGGCGGCACATTTCCAATTGATTTCTCGAGAAATCAATTGGAAATGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026232.1-292s1c1
Sequence:CCGGCCAGACAAATGATGCCAACTTCTCGAGAAGTTGGCATCATTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026232.1-599s1c1
Sequence:CCGGGCTGTTCAAGGAGGCATGATACTCGAGTATCATGCCTCCTTGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026232.1-545s1c1
Sequence:CCGGGCTATTGCTAATCCGACTGATCTCGAGATCAGTCGGATTAGCAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026232.1-1025s1c1
Sequence:CCGGACTTACGAACAACTGAAGAAACTCGAGTTTCTTCAGTTGTTCGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026232
SLC25A30 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25, member 30
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026232.3-1286s21c1
Sequence:CCGGCTAGATAACTGATGTACATAACTCGAGTTATGTACATCAGTTATCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026232.3-243s21c1
Sequence:CCGGCGGCACATTTCCAATTGATTTCTCGAGAAATCAATTGGAAATGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026232.1-292s1c1
Sequence:CCGGCCAGACAAATGATGCCAACTTCTCGAGAAGTTGGCATCATTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026232.1-599s1c1
Sequence:CCGGGCTGTTCAAGGAGGCATGATACTCGAGTATCATGCCTCCTTGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026232.1-545s1c1
Sequence:CCGGGCTATTGCTAATCCGACTGATCTCGAGATCAGTCGGATTAGCAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026232.1-1025s1c1
Sequence:CCGGACTTACGAACAACTGAAGAAACTCGAGTTTCTTCAGTTGTTCGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026232
SLC25A30 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25, member 30
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026232.3-1286s21c1
Sequence:CCGGCTAGATAACTGATGTACATAACTCGAGTTATGTACATCAGTTATCTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026232.3-243s21c1
Sequence:CCGGCGGCACATTTCCAATTGATTTCTCGAGAAATCAATTGGAAATGTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026232.1-292s1c1
Sequence:CCGGCCAGACAAATGATGCCAACTTCTCGAGAAGTTGGCATCATTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026232.1-599s1c1
Sequence:CCGGGCTGTTCAAGGAGGCATGATACTCGAGTATCATGCCTCCTTGAACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026232.1-545s1c1
Sequence:CCGGGCTATTGCTAATCCGACTGATCTCGAGATCAGTCGGATTAGCAATAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026232.1-1025s1c1
Sequence:CCGGACTTACGAACAACTGAAGAAACTCGAGTTTCTTCAGTTGTTCGTAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)